Дисбиоз кишечника: Дисбиоз кишечника — симптомы и диагностика, цены на лечение дисбактериоза в Москве в клинике Хадасса

Содержание

Дисбактериоз кишечника. Как лечить дисбактериоз

Организм человека – очень сложная и слаженная система, для нормальной работы которой важно поддержание внутреннего баланса. Но у организма есть и помощники – полезные бактерии, живущие в кишечнике. Они помогают переваривать пищу, получать питательные вещества, более того, они необходимы для работы иммунной системы и защищают организм от распространения вредных, патогенных бактерий. Однако иногда баланс микроорганизмов нарушается, что приводит к неприятным последствиям – развивается дисбактериоз.

Дисбактериоз кишечника – это нарушение состава нормальной микрофлоры кишечника. Количество полезных бактерий снижается, а патогенные микроорганизмы начинают усиленно размножаться. Это заболевание приводит к расстройству пищеварения, дефициту некоторых микроэлементов, снижению иммунитета и плохому самочувствию.

Дисбактериоз кишечника встречается очень часто: по некоторым данным ему подвержены до 90% всех взрослых людей. Еще чаще возникает дисбактериоз кишечника у детей – 95% грудных малышей страдают от этого заболевания. Причин дисбактериоза множество: плохая экология, хронический стресс, неправильное питание. Кроме того, дисбактериоз кишечника может быть вызван бесконтрольным применением антибиотиков и иммунодепрессантов. У детей он часто возникает в связи с переходом на искусственное вскармливание. В то время как грудное молоко богато полезными микроорганизмами и помогает заселить ими кишечник ребенка, искусственные смеси могут нарушить состав микрофлоры и привести к дисбактериозу.

Как лечить дисбактериоз?

Если по тем или иным причинам баланс нормальной кишечной микрофлоры был нарушен и развился дисбактериоз кишечника, лечение лучше начинать сразу, до перехода состояния в затяжную форму и развития более серьезных симптомов. Лечение дисбактериоза должно быть комплексным, поэтому как лечить дисбактериоз в каждом конкретном случае лучше всего расскажет лечащий врач. Дело в том, что дисбактериоз не является самостоятельным заболеванием и может быть симптомом различных болезней, чтобы избавиться от дисбактериоза, необходимо вылечить в первую очередь заболевание его вызвавшее.

Тем не менее, существуют общие рекомендации по лечению дисбактериоза кишечника. Для нормализации состава микрофлоры кишечника применяют, так называемые, бактериальные препараты, например, Линекс, Бификол, Энтерол и другие. Эти препараты содержат живые культуры, характерные для нормальной микрофлоры и помогут восстановить баланс. Кроме того, при дисбактериозе полезно употребление продуктов, содержащих лактобактерии и бифидобактерии. Для нормализации работы пищеварительной системы стоит исключить из рациона продукты, раздражающие слизистую кишечника, т.е. на время отказаться от острого, соленого и маринованного. Для того, чтобы предотвратить распространение патогенных микроорганизмов при дисбактериозе кишечника иногда применяют антибактериальные препараты. Однако выбор препарата и продолжительность курса должен оценивать врач. Применение антибиотиков без рекомендации врача может привести к усугублению дисбактериоза.

Ещё статьи:

причины, симптомы, диагностика, лечение дисбиоза кишечника

11 Октября 2012 г. Записаться на прием

Кожа и слизистые каждого человека содержат огромное количество различных микроорганизмов, играющих важную роль в нормальном функционировании организма. Порядка 65% микроорганизмов сосредоточены в желудочно-кишечном тракте, и эти бактерии выполняют очень ответственную функцию – обеспечивают местный и общий иммунитет, защищая организм от проникновения патогенной микрофлоры и развития инфекционных заболеваний, помогают переваривать и усваивать питательные вещества, а также участвуют в ферментативных процессах, вырабатывая витамины и биологически активные вещества.

В норме микрофлора кишечника поддерживает иммунитет и препятствует развитию пищевой аллергии. Однако наряду с полезными бактериями (бифидо- и лактобактериями, кишечной палочкой, анаэробными стрептококками, энтерококками), в кишечнике может обитать и так называемая условно-патогенная микрофлора. Условно-патогенная микрофлора — микроорганизмы, не приносящие вреда здоровому человеку, но способные, при возникновении неблагоприятных условий, служить причиной развития некоторых заболеваний.

Дисбактериоз (дисбиоз) кишечника – это состояние, при котором нарушается баланс полезных и патогенных микроорганизмов. По сути, дисбактериоз – не самостоятельное заболевание, а симптом, свидетельствующий об определенных проблемах с деятельностью желудочно-кишечного тракта.

Причины дисбактериоза кишечника

  • Некоторые заболевания желудочно-кишечного тракта (хронический гастрит, хронический панкреатит, хронический холецистит, дискинезия желчного пузыря и желчевыводящих путей, хронический гепатит, цирроз печени, язва желудка и др.).
  • Нерациональное питание (пища с дефицитом витаминов и питательных веществ), резкая перемена пищевого режима, голодание, злоупотребление диетами, истощение организма.
  • Онкологические заболевания.
  • Терапия некоторыми лекарственными препаратами.
  • Сниженный общий и местный иммунитет.
  • Перемена климата.
  • Пожилой возраст.

Симптомы дисбактериоза кишечника

  • Тошнота, рвота, отрыжка.
  • Спастическая боль в животе, урчание.
  • Вздутие живота, метеоризм.
  • Диарея, чередующаяся с запорами.
  • Изменение цвета и формы стула («овечий» кал).
  • Металлический привкус во рту (неспецифический признак).
  • Общая слабость, утомляемость, снижение работоспособности.
  • Бессонница, нарушения сна.
  • Головная боль.
  • Сухость кожи и слизистых оболочек (неспецифический признак).
  • Аллергические реакции (зуд кожи и др.).

Диагностика дисбактериоза

  • Консультация гастроэнтеролога, сбор анамнеза.
  • Микробиологическое исследование кала.
  • Посев кала на условно-патогенную флору.
  • Посев кала на дисбактериоз.
  • Копрограмма.

Дифференциальная диагностика дисбактериоза проводится с острыми кишечными инфекциями, муковисцидозом, целиакией, синдромом мальабсорбции и другими заболеваниями.

Лечение дисбактериоза кишечника

Лечение дисбактериоза кишечника зависит прежде всего от причины дисбиоза. Довольно часто устранить проявления дисбактериоза кишечника можно, проведя простые мероприятия – например, прекратив антибактериальную терапию, проводимую пациентом, или нормализовав режим его питания. При назначении схемы лечения дисбактериоза кишечника очень важно учитывать имеющиеся у пациента хронические заболевания желудочно-кишечного тракта.

Важной частью терапии дисбактериоза кишечника является лечение специальными препаратами, содержащими концентрацию бактерий, дефицит которых испытывает организм пациента – пробиотики, пребиотики, синбиотики. Возможно применение специфических препаратов – бактериофагов, а также витаминных комплексов, сорбентов, иммуномодулирующих средств. Антибактериальная терапия для лечения дисбактериоза кишечника назначается строго индивидуально по показаниям.

Дисбактериоз – состояние, не формирующее иммунитет у пациента. Эффективное лечение дисбактериоза кишечника заключается прежде всего в профилактике возможных заболеваний желудочно-кишечного тракта, а также устранении факторов, способных стать причиной развития дисбактериоза кишечника.

Мучаетесь от дисбактериоза? Высококвалифицированные врачи ГУТА КЛИНИК в кратчайшие сроки установят точную причину дисбактериоза кишечника и помогут вам решить проблемы со здоровьем!

Дисбиоз кишечника, повышение проницаемости кишечной стенки и неалкогольная жировая болезнь печени | Успенский

1. Bellentani S., Scaglioli F., Marino M., Bedogni G. Epidemiology of non-alcoholic fatty liver disease // Dig Dis. — 2010. — Vol. 28. — P. 155–161.

2. Драпкина О. М. Неалкогольная жировая болезнь печени как компонент метаболического синдрома. / О. М. Драпкина, Д. С. Гацолаева, В. Т. Ивашкин // Российские медицинские вести. — 2010. — № 2. — с. 72–78.

3. Ota T., Takamura T., Kurita S., Matsuzama N., Kita et al. Insulin resistance accelerates a dietary model of nonalcoholic steatohepatitis // Gastroenterology 2007. — Vol. — 132. — P. 282–293.

4. Буеверов А. О., Маевская М. В. Некоторые патогенетические и клинические вопросы неалкогольного стеатогепатита // Клин. перспективы гастроэнтерол., гепатол. 2003; 3: 2–7.

5. Farhadi A., Gundlapalli S., Shaikh M. et al. Susceptibility to gut leakiness: a possible mechanism for endotoxaemia in non-alcoholic steatohepatitis // Liver Int. 2008; 28 (7): 1026–1033.

6. Чихачева Е., Тетерина Л., Селиверстов П., Добрица В. Радченко В. Нарушения микробиоценоза кишечника у пациентов с хроническими заболеваниями печени // Врач, 2012. — № 7. С. 34–39.

7. Vajro P., Paolella G., Fasano A. Microbiota and gut-liver axis: their influences on obesity and obesity-related liver disease // J. Pediatr. Gastroenterol. Nutr. 2013; 56 (5): 461–468.

8. El Asmar R., Panigrahi P., Bamford P. et al. Host-dependent activation of the zonulin system is involved in the impairment of the gut barrier function following bacterial colonization // Gastroenterology. 2002; 123: 1607–1615.

9. Moreno-Navarrete J.M., Sabater M., Ortega F. et al. Circulating zonulin, a marker of intestinal permeability, is increased in association with obesity-associated insulin resistance // PLoS One. 2012; 7: e37160.

10. Агафанова Н. А., Васильев И. В., Гусаимова Т. А., Иванов А. Н. Метаболические заболевания печени как системные проявления дисбактериоза кишечника. Роль пробиотиков в нормализации кишечной микрофлоры // Русский медицинский журнал. — 2008. — Т. 16. — № 6. — С. 396–402.

11. Cesaro C., Tiso A., Del. Prete A. Gut microbiota and probiotics in chronic liver diseases // Dig. Liver Dis. — 2011. — Vol. 43 (6). — P. 431–438.

12. Rotter V., Nagaev I., Smith U. Interleukin — 6 Induces Insulin Resistance in 3T3 — L1 Adipocytes and Is, Like interleukin-8 and Tumor Necrosis Factor–a, Overexpressed in Human Fat Сells from Insulin — resistant Subjects // Biol. Chem. — 2003. — Vol. 278. — N 46. — P. 45777–45784.

13. Cai D., Yuan M., Frantz D. F. et al. Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB // Nat. Med. — 2005. — Vol. 11. — N 2. — P. 183–190.

14. Iian Y. Leaky gut and the liver: a role for bacterial translocation in nonalcoholic steatohepatitis // World J. Gastroenterol. 2012. — Vol. 18 (21). — P. 2609–2618.

15. Sahai A., Malladi P., Melin-Aldana H. et al. Progress in understanding the pathogenesis of nonalcoholic fatty liver disease // Hepatology. — 2005. — Vol. 41, N 1. — P. 204–206.

16. Pearson JP, Foster SN. Mucus glycoprotein content of human cholesterol gallstones. Digestion. 1987; 36: 132–140.

17. Eusufzai S. Bile acid malabsorption: mechanisms and treatment. Dig Dis. 1995 Sep–Oct; 13 (5): 312–21.

18. Балукова Е. В., Барышникова Н. В., Белоусова Л. Н. Неалкогольная жировая болезнь печени: современное состояние проблемы // Фарматека. 2016. № 2 (315). С. 63–68.

19. Барышникова Н. В., Фоминых Ю. А., Балукова Е. В., Успенский Ю. П. Дисбиоз кишечника — инфекция Helicobacter pylori — синдром раздраженного кишечника — метаболический синдром: что их объединяет? Практическая медицина. 2012. № 3 (58). С. 11–16.

20. С. Ю. Марцевич, Н. П. Кутишенко, Л. Ю. Дроздова, О. В. Лерман, В. А. Невзорова, И. И. Резник, Г. В. Шавкута, Д. А. Яхонтов. Рабочая группа исследования РАКУРС. Исследование РАКУРС: повышение эффективности и безопасности терапии статинами у больных с заболеваниями печени, желчного пузыря и (или) желчевыводящих путей с помощью урсодеоксихолевой кислоты. Терапевтический архив. — 2014. — № 12. С. 48–52.

21. Исследование «УСПЕХ»: Урсосан ® снижает риск сердечно-сосудистых осложнений у пациентов с НАЖБП [электронный ресурс]. URL: ursosan.ru/arh/issledovanie-%C2%ABuspex%C2%BB-ursosan%C2%AE-snizhaet-risk-serdechno-sosudistyix-oslozhnenij-u-paczientov-s-nazhbp/ (дата обращения 10.12.2019).

22. Селиверстов П. В. Взаимоотношения печени и кишечника на фоне дисбаланса микрофлоры толстой кишки / П. В. Селиверстов, В. Г. Радченко, И. Г. Сафронова, С. И. Ситкин // Гастроэнтерология Санкт-Петербурга. — 2010. — № 2–3. — С. 15–18.

Признаки и причины дисбактериоза — сеть клиник НИАРМЕДИК

Симптомы дисбактериоза кишечника

Симптомы дисбактериоза кишечника у взрослых и детей аналогичны признакам различных заболеваний желудочно-кишечного тракта, которые сопровождаются следующими проявлениями:

  • отрыжкой;
  • тошнотой;
  • изжогой;
  • вздутием живота;
  • поносами;
  • запорами;
  • неприятным привкусом во рту;
  • неприятным запахом изо рта;
  • болями в животе;
  • аллергическими реакциямидаже на безобидные продукты питания;
  • субфибрильной температурой.

При дисбактериозе в первую очередьпод удар попадаетпроцесс пищеварения. Пищу в кишечнике сначала расщепляют бактерии, а уже потом она всасывается в кровь. Без содействияполезных микробовчеловеческий организм не может полноценно усвоить необходимые питательные вещества. Поэтому и появляются такие признаки дисбактериоза кишечника как тошнота, рвота, жидкий стул и т.п.

Диагностика дисбактериоза

Для определения наличия и характера дисбактериоза кишечника необходимо сдать анализ, чтобы выяснить, какие именно микроорганизмы и в каком количестве населяют кишечник. Применяются следующие методы диагностики:

  • Бактериологическое исследование. Результат данного анализа готовится восемь дней – именно столько времени в среднем нужно для того, чтобы бактерии выросли в специальных питательных средах и стали доступны для выявления. Качество результатов зависит от соблюдения сроков доставки, от качества материала и особенностей и трудностей культивирования отдельных видов бактерий.
  • Метод обследования метаболитов микрофлоры, основанный на определении летучих жирных кислот, выделяемых микробами в процессе своего развития. Способ отличается высокой чувствительностью и очень прост в определении микробов, а также позволяет получить результат уже в течение нескольких часов.

Необходимо учитывать, что состав микрофлоры кишечника у каждого человека индивидуален. Это зависит от возраста, рациона питания, и даже от времени года. Потому одних лишь анализов для установления диагноза недостаточно. Обычно требуется дополнительное обследование для выявления причин дисбактериоза.

На сегодняшний день не существует ни одного способа диагностики, который позволил бы уверенно говорить о наличии кишечного дисбактериоза. Симптомы, приписываемые этому заболеванию, обычно являются проявлениями какого-либо основного заболевания. Малоинформативным является даже широко распространенный анализ на дисбактериоз у детей. Копроскопия не дает совсем никакой информации о микроорганизмах в кишечнике, только выявить наличие паразитов в некоторых случаях.

Лечение дисбактериоза

В сети клиник НИАРМЕДИК в большинстве случаев проводят комплексное лечение дисбактериоза кишечника у взрослых и детей, так как заболевание часто связано с нарушением моторики кишечника, синдромом раздраженного кишечника, а также психоэмоциональными нарушениями. Выбор методовлечения зависит от того, как протекает заболевание, на фоне которого проявляется кишечный дисбактериоз, а также от преобладающих симптомов.

Эффективные мероприятия по лечению дисбактериоза обычно направлены на то, чтобы:

  • изменить образ жизни,
  • соблюдать диету.

Огромное значение в терапии дисбактериоза имеет пересмотр образа жизни и правильное питание. Пациентам рекомендуется:

  • избегать работы, требующей большой физической нагрузки;
  • избегать психоэмоциональных потрясений и стрессовых ситуаций;
  • дозировать регулярную физическую нагрузку – это оказывает положительное влияние на нервную систему и позволяет избавиться от депрессии.

Основные принципы питания при дисбактериозе

  • кишечник должен быть максимально защищен от механического, химического и термического воздействия пищи;
  • еда должна быть полноценной и разнообразной;
  • пища должна содержать все необходимые витамины и микроэлементы;
  • питаться следует по определенному графику в строго определенные часы;
  • последний прием пищи должен быть не позднее, чем за три часа до сна;
  • кушать следует медленно, хорошо пережевывая пищу, не отвлекаясь на чтение, разговоры или просмотр телевизора;
  • соблюдать рекомендации врача по употреблению или же исключения из рациона тех или иных продуктов;
  • устранить избыточное размножение вредных микроорганизмов в кишечнике.

Лечение антибиотиками должно осуществляться исключительно по показаниям врача. Антибактериальные препараты применяются только при сильном дисбактериозе с угрозой попадания микробов из кишечника в кровь и развитии сепсиса.

В остальных случаях лечение начинают с кишечных антисептиков, которые назначаются на 10-14 дней. Данные препараты оказывают более мягкое воздействие, не нарушают нормальную микрофлору, и при этом значительно снижают количество болезнетворных бактерий. Если антисептики не дали эффекта, могут назначить антибиотики.

Имплантировать нормальную кишечную микрофлору

Для восстановления микрофлоры применяются пробиотики — препараты, которые содержат представителей нормальной флоры кишечника и пребиотики — лекарства, облегчающие их выживание и размножение в кишечнике.

Самые изученные и полезные бактерии для кишечника – это бифидо и лактобактерии. Пробиотики применяются регулярно, длительно (в течение 1-2-х месяцев) и дозировано.

Повысить иммунитет для создания естественной микрофлоры кишечника

Пациентам со сниженным иммунитетом могут назначить иммуностимуляторы и витамины в дополнение к диете.

Также могут применяться адсорбенты – препараты, которые обладают вяжущим и обволакивающим действием, а также впитывают растворы токсинов.

Профилактика дисбактериоза кишечника

Профилактика дисбактериоза состоит из лечения антибактериальными средствами, обязательного общеукрепляющего лечения и полноценного питания для ослабленных пациентов.

Дисбиоз (дисбактериоз) кишечника | ФБУН «Ростовский научно-исследовательский институт микробиологии и паразитологии» Роспотребнадзора

Высококвалифицированные сотрудники нашего института  осуществляют:

1.    Бактериологический посев на дисбактериоз кишечника + чувствительность к бактериофагам, противогрибковым препаратам и антибиотикам до и после лечения. Данные исследования проводят с целью  выявления наличия бактерий, вызывающих такие заболевания, как дизентерия, сальмонеллез, брюшной тиф, а также нарушение микробного состава.

2.   Копрологические исследования (копрограмма). Этот вид исследования кала позволяет диагностировать нарушение функций желудка, поджелудочной железы, печени, ускоренного прохождения пищи через желудок и кишечник, нарушение всасывания в тонкой кишке; воспалительный процесс в желудочно-кишечном тракте, язвенный, аллергический и спастический колит.

3. Наличие кишечных ферментов (энтерокиназы, липазы, амилазы и др.). Показатель количества и эффективности работы пищеварительных ферментов в тонком кишечнике.

4.    Кишечные вирусы (ротавирусы, норовирусы, энтеровирусы, астровирусы) – могут вызывать острые инфекционные заболевания с разной степенью выраженности (бессимптомно, в легкой форме – с однократной рвотой и поносом, а также в тяжелой форме с выраженной интоксикацией). Особенно кишечные инфекции опасны у детей до 1-го года. Подтверждение присутствия вирусов в кале необходимо для выбора правильной тактики лечения больного.

         При исследовании кишечника в институте применяются новые, высокотехнологические методы, основанные на выявлении местных иммунологических и метаболических процессов, протекающих в кишечнике, что позволяет улучшить диагностику, лечение и профилактику заболеваний кишечника.

     Клинические анализы выполняются как «классическим» бактериологическим методом, так и с применением бактериологических анализаторов Vitek-2, масс-спектрометра Bruker, ПЦР в режиме real-time и др.

Важно отметить, что обратившийся в наш институт за медицинским обследованием человек получает максимально возможную информацию из одной пробы материала, что значительно облегчает обследование пациентов и дает максимально полную информацию для лечащего врача. 

 

Исследование микробиоценоза кишечника (дисбактериоз)

Код услуги

77010190

Описание

Дисбактериоз кишечника, синдром избыточного бактериального роста, дисбиоз кишечника.  Цель исследования.изучение флоры толстой кишки , выявление дисбиотических состояний. Определение чувствительности выделенной условно-патогенной микрофлоры к бактериофагам. Исследуемый материал.Кал. Показания к исследованю. Длительно протекающие кишечные расстройства. Затянувшийся период реконвалесценции после ОКИ. Дисфункция кишечнника у лиц , длительно подвергающихся воздействию вредных факторов ( излучение, химиотерапия, гормональная терапия). Наличие системной воспалительной реакции или бактериемии. Частые респираторные инфекции. Аллергические заболевания.  Диагностическое значение.Кишечная микрофлора это весьма лабильная система, подверженная колебаниям. Поэтому чтобы отличить так называемые временные вариации состава микрофлоры от дисбактериоза необходимо проведение кратных исследований с интервалом в несколько дней.  По характеру отклонений микрофлоры кишечника от нормы условно выделяют 3 степени дисбактериоза: I степень — незначительное снижение количества бифидо и лактобактерий на 1-2 степени, снижение содержания кишечной палочки с нормальной ферментативной активностью или появление измененных кишечных палочек (лактозоотрицательных и гемолитических)  II степень — снижение концентрации бифидобактерий  и лактобактерий,  повышение численности условно — патогенных микроорганизмов, III степень — значительной снижение или полное отсутствие бифидобактерий и лактобактерий, численное превосходство условно — патогенных энтеробактерий, псевдомонад, кандид, стафилококков. Подготовка к исследованию.  Кал собирают в стерильный контейнер с ложечкой сразу после дефекации в количестве 1-2 г. При запорах можно использовать слабительные средства только растительного происхождения (сена , свекла, слабительный чай, чернослив) Кал должен быть нормальной консистенции. Нельзя использовать клизму. Микробиологическое исследование производится не ранее, чем через 7-10 дней после прекращения приема антибиотиков, химиопрепаратов. Результат через 5 рабочих дней. Результат бактериологического исследования не является диагнозом. Диагноз ставит только лечащий врач  на основании совокупности результатов различных исследований, общего состояния пациента, клинической картины.

Подготовка

Кал для исследования отбирается из средней порции в количестве 1-2г (2 ложечки) в специальный стерильный контейнер. При запорах можно использовать слабительные средства только растительного происхождения (сена, слабительный чай,чернослив, свекла). Кал должен быть нормальной консистенции. Нельзя использовать клизму. Доставка кала в течение 2 часов, кроме воскресенья.

ДИСБИОЗ КИШЕЧНИКА У ДЕТЕЙ С ПИЩЕВОЙ АЛЛЕРГИЕЙ: ПАТОГЕНЕТИЧЕСКИЕ АСПЕКТЫ И СОВРЕМЕННЫЕ МЕТОДЫ КОРРЕКЦИИ | Макарова

1. Kalliomaki M., Kirjavainen P., Eerola E. et al. Distinct patterns of neonatal gut microflora in infants developing or not developing atopy. J. Allergy Clinical Immunology. 2001; 107: 129–134.

2. Ouwehand A.C., Isolauri E., He F. et al. Differences in Bifidobacterium flora composition in allergic and healthy infants. Journal of Allergy and Clinical Immunology. 2001; 108: 144–145.

3. Ogden N.S., Bielory L. Probiotics: a complementary approach in the treatment and prevention of pediatric atopic disease. Current Opinion in Allergy and Clinical Immunology. 2005; 5: 179–184.

4. Куваева И.Б., Ладодо К.С. Микро–экологические и иммунные нарушения у детей. М.: Медицина. 1991. 432 c.

5. Балаболкин И.И., Гребенюк В.Н. Атопический дерматит у детей. М.: Медицина. 1999. 240 с.

6. Макарова С.Г., Боровик Т.Э., Ладодо К.С. и др. Состояние кишечного микробиоценоза у детей с атопическим дерматитом в зависимости от особенностей клинической картины и формы заболевания. Педиатрия. 1997; 2: 19–24.

7. Isolauri E., Gotteland M., Heyman M. et al. Antigen absorption in rabbit bacterial diarrhea. Dig. Dis. Sci. 1990; 35: 350–366.

8. Batt R.M., Hall E.J., McLean L., Simpson K.W. Small intestinal bacterial overgrowth and enhanced intestinal permeability in healthy beagles. Am J. Vet. Res. 1992; 53 (10): 1935–1940.

9. Salzman A.L., Wang H., Wollert P.S. et al. Endotoxin induced ileal mucosal hyperpermeability in pigs: role of tissue acidosis. Am. J. Physiol. 1994; 266 (4): 633–646.

10. Беклемишев Е.Д., Суходоева Д.С. Аллергия к микробам в клинике и эксперименте. М.: Медицина. 1979. 315 с.

11. Martin R.R., White A. The in vitro release of leukocyte histamine by staphylococcal antigens. J. Immunology. 1969; 102: 437–441.

12. Espersen F., Jarlov J.О., Jensen C. et al. Staphylococcus aureus peptidoglican induces histamine release from basophil human leukocytes in vitro. Infection and Immunity. 1984; 46: 710–714.

13. GrossBWeege V., Konig V., Scheffer J., Nimmich W. Induction of histamine release from rat mast cells and human basophilic granulocites by clinical Escherihia coli isolates and relation to hemolysin production and adhesin expression. J. Clinical Microbiology. 1988; 26 (9): 1831–1837.

14. Norn S., Jarlov J.0., Jensen С. et al. Bacteria and their products peptidoglycan and teichoic acid potentiate antigen induced histamine release in allergic patients. Agents and Actions. 1987; 20: 174–179.

15. Jensen C., Norn S., Stahl Skov P. et al. Bacterial histamine release by immunological and nonBimmunological lectin mediated reactions. Allergy. 1986; 39: 371–377.

16. Адо А.Д. Аллергия без иммунологии. Клиническая медицина. 1983; 5: 4–7.

17. Smith A.M., Hayden M.A., McCay S.G. et al. Detection and confirmation of histamineBproducing bacteria. Bull. Envirom. Contam. Toxicol. 1982; 29: 618–623.

18. NugonBBaudon L., Szylit O., Chaignean M. et al. Production diamines in vitro et in vivo par une souche de lactobacille isolee d’un jabot de cag. Ann. Inst. Pasteur Microbiol. 1985; 136: 63–73.

19. Шендеров Б.А., Климнюк С.И., Кардашева Е.В. Медицинские аспекты микробной экологии. М. 1994. Ч. 1. Вып. 7–8. С. 71–82.

20. Мазитова О.И., Фиш Н.Г., Кулинич Л.И. и др. Оценка сенсибилизации к кишечной микрофлоре при аллергических заболеваниях. Советская медицина. 1987; 5: 31–33.

21. Dhar S., Kanwar A.J., Kaur S. et al. Role of bacterial flora in the pathogenesis and management of atopic dermatitis. Indian. J. Med. Res. 1992; 95: 234–238.

22. Leung D.Y., Harbeck R., Bina P. et al. Presence of IgE antibodies to staphylococcal exotoxins on the skin of patients with atopic dermatitis. Evidence for a new group of allergens. J. Clin. Invest. 1993; 92 (3): 1374–1380.

23. Макарова С.Г., Боровик Т.Э., Балаболкин И.И. Роль диетотерапии в коррекции дисбиотических нарушений у детей раннего возраста с атопическим дерматитом, обусловленным пищевой сенсибилизацией. Вопросы детской диетологии. 2003; 1: 34–38.

24. Макарова С.Г., Балаболкин И.И., Боровик Т.Э. Пищевая аллергия и дисбактериоз кишечника. Диетологические подходы. Вопросы детской диетологии. 2004; 2 (1): 56.

25. He F., Ouwehand A.C., Isolauri E. et al. Comparison of mucosal adhesion and species identification of bifidobacteria isolated from healthy and allergic infants. FEMS Immunology and Medical Microbiology. 2001; 30: 43–47.

26. Laiho K., Hoppu U., Ouwehand A.C. et al. Probiotics: on going research on atopic individuals. British J. Nutrition. 2002; 88 (1): 19–27.

27. Morelli L. Probiotics: clinics and/or nutrition. Digest Liver Dis. 2002; 34 (2): 8–11.

28. Sutas Y., Hurme M. & Isolauri E. DownBregulation of antiBCD3 antibody induced IL 4 production by bovine caseins hydrolysed with Lactobacillus GGBderived enzymes. Scandinavian J. Immunology. 1996; 43: 687–689.

29. Wollowski I., Rechkemmer G., PoolBZobel B.L. Protective role of probiotics and prebiotics in colon cancer. American Journal of Clinical Nutrition. 2001; 73: 451–455.

30. Pessi T., Sutas Y., Marttinen A. & Isolauri E. Probiotics reinforce mucosal degradation of antigens in rats: implications for therapeutic use of probiotics. J. Nutrition. 1998; 128: 1312–1318.

31. Majamaa H., Isolauri E., Saxelin M & Veskari T () Lactic acid bacteria in the treatment of acute rotavirus gastroenteritis. J. Pediatric Gastroenterology Nutrition. 1995; 20: 333–338.

32. Yasui H., Nagaoka N., Mike A. et al. Detection of Bifidobacterium strains that induce large quantities of IgA. Microbiol. Ecology Health Disease. 1992; 5: 155–162.

33. Matsuzaki T., Yamazaki R., Hashimoto S., Yokokura T. The effect of oral feeding of Lactobacillus casei strain Shirota on immunoglobulin E production in mice. J. Dairy Science. 1998; 81: 48–53.

34. Kirjavainen P.V., Apostolou E., Salminen S.J., Isolauri E. New aspects of probiotics — a novel approach in the management of food allergy. Allergy. 1999; 54: 909–915.

35. Sanfilippo L., Li C.K., Seth R. et al. Bacteroides fragilis enterotoxin induces the expression of IL 8 and transforming growth factor beta (TGFBbeta) by human colonic epithelial cells. Clinical Exp. Immunol. 2000; 119: 456–463.

36. Benno Y., He F., Hosoda M. et al. Effect of Lactobacillus GG yogurt on human intestinal microecology in Japanese subjects. Nutrition Today. 1996; 31 (Suppl. 6): 9–11.

37. Kalliomaki M., Salminen S., Arvilommi H. et al. Probiotics in primary prevention of atopic disease: a randomised placebo-controlled trial. Lancet. 2001; 357: 1076–1079.

38. Kalliomaki M., Salminen S., Arvilommi H. et al. Probiotics in primary prevention of atopic disease: a randomised placebo-controlle trial. Lancet. 2001; 357: 1076–1079.

39. Kalliomaki M., Salminen S., Arvilommi H. et al. Probiotics in primary prevention of atopic disease: a randomised placebo-controlled trial. Lancet. 2001; 357: 1076–1079.

40. Pessi T., Sutas Y., Hurme M. et al. Interleukin 10 generation in atopic children following oral Lactobacillus rhamnosus GG. Clin. Exp. Allergy. 2000; 30: 1804–1808.

41. Kalliomaki M., Isolauri E. Pandemic of atopic diseases — a lack of microbial exposure in early infancy? Curr. Drug Targets Infect. Disord. 2002; 2: 193–199.

42. Kalliomaki M., Salminen S., Poussa T. et al. Probiotics and prevention of atopic disease: 4Byear followBup of a randomised placebo-controlled trial. Lancet. 2003; 361: 1869–1871.

43. Isolauri E., Arvola T., Sutas Y. et al. Probiotics in the management of atopic eczema. Clin. Exp. Allergy. 2000; 30: 1604–1610.

44. Penttila I. Effects of transforming growth factor beta and formula feeding on systemic immune responses to dietary beta lacto globulin in allergy prone rats. Pediatr. Res. 2006; 59 (5): 650–655.

45. Rautava S., Kalliomaki M., Isolauri E. Probiotics during pregnancy and breastfeeding might confer immunomodulatory protection against disease in the infant. J. Allergy Clin. Immunol. 2002; 109 (1): 119–121.

46. Majamaa H., Isolauri E. Probiotics: a novel approach in the management of food allergy. J. Allergy Clin. Immunol. 1997; 99: 179–185.

47. Bai А.Р., Ouyang Q., Zhang W. et al. Probiotics inhibit TNFA induced interleukin 8 secretion of HT29 cells. J. Gastroenterology. 2004; 10 (3): 455–457.

48. Rosenfeldt V., Benfeldt E., Nielsen S.D. et al. Effect of probiotic Lactobacillus strains in children with atopic dermatitis. J. Allergy Clin. Immunol. 2003; 112: 223–227.

49. Mastrandrea F., Coradduzza G., Serio G. et al. Probiotics reduce the CD34+ hemopoietic precursor cell increased traffic in allergic subjects. Allerg. Immunol. 2004; 36: 118–122.

50. Hattori K., Yamamoto A., Sasai M. et al. Effects of administration of bifidobacteria on fecal microflora and clinical symptoms in infants with atopic dermatitis. Arerugi. 2003; 52: 20–30.

51. Laiho K., Hoppu U., Ouwehand A.C. et al. Probiotics: on going research on atopic individuals. British J. Nutrition. 2002; 1 (88): 19–27.

52. Gibson G.R., Roberfroid М. Dietary modulation of the human colonic microbiota: Introducing the concept of prebiotics. J. Nutr. 1995; 1256: 1401–1412.

53. Roberfroid M.B. InulinBtype fructans: functional food ingredients. J. Nutr. 2007; 137: 830–837.

54. European Society of Pediatric Allergy and Clinical Immunology. Hydrolysed cow’s milk formulae. Allergenicity and use in treatment and prevention. An ESPACI position. Pediatr. Allergy Immunol. 1995; 6: 56.

55. ESPGAN Committee on Nutrition. Comment on antigen reduced infant formulae. Acta Paediatr. 1993; 82: 314–319.

56. Макарова С.Г., Боровик Т.Э., Балаболкин И.И., Ревякина В.А. Использование продуктов, способствующих нормализации кишечного биоценоза, при пищевой аллергии у детей раннего возраста. Аллергология. 2001; 1: 29–33.

57. Мазанкова Л.Н., Лыкова Е.А., Шевелева С.А. Пробиотики: систематизация препаратов и тактика их применения у детей. Вестник педиатрической фармакологии нутрициологии. 2005; 2 (3): 4–10.

58. Урсова Н.И. Дисбактериозы кишечника у детей. Руководство для врачей. М. 2006. 240. с

59. Осипова И.Г. Экспериментально–клиническое изучение споровых пробиотиков. Автореф. дис. … докт. мед. наук. М. 2006. 48 c.

60. Щербаков П.Л., Петухов В.А. Сравнительная эффективность энтеросорбентов при диарее у детей. Вопросы современной педиатрии. 2005; 4 (4): 86–90.

Дисбиоз кишечника новорожденных | Журнал перинатологии

  • Домингес-Белло М.Г., Годой-Виторино Ф., Найт Р., Блазер М.Дж. Роль микробиома в развитии человека. Кишка. 2019;68:1108–14.

    КАС пабмед ПабМед Центральный Google ученый

  • Генсоллен Т., Айер С.С., Каспер Д.Л., Блумберг Р.С. Как колонизация микробиотой в раннем возрасте формирует иммунную систему. Наука. 2016; 352: 539–44.

    КАС пабмед ПабМед Центральный Google ученый

  • Айрес Дж.С.Совместное поведение микробной толерантности при мутуализме микробиоты-хозяина. Клетка. 2016; 165:1323–31.

    КАС пабмед ПабМед Центральный Google ученый

  • Санчес К.К., Чен Г.Ю., Шибер А.П., Редфорд С.Е., Шохирев М.Н., Леблан М. и др. Совместная метаболическая адаптация у хозяина может способствовать бессимптомной инфекции и выбирать ослабленную вирулентность кишечного патогена. Клетка. 2018;175:146–58.e15.

    КАС пабмед ПабМед Центральный Google ученый

  • Сорбара М.Т., Памер Э.Г.Межбактериальные механизмы колонизационной резистентности и стратегии их преодоления патогенами. Иммунол слизистых оболочек. 2019; 12:1–9.

    КАС пабмед ПабМед Центральный Google ученый

  • Koh A, Bäckhed F. От ассоциации к причинно-следственной связи: роль кишечной микробиоты и ее функциональных продуктов в метаболизме хозяина. Мол Ячейка. 2020; 78: 584–96.

    КАС пабмед ПабМед Центральный Google ученый

  • Геверс Д., Кугатасан С., Денсон Л.А., Васкес-Баеза Ю., Ван Треурен В., Рен Б. и др.Нелеченный микробиом при впервые возникшей болезни Крона. Клетка. Хост-микроб. 2014;15:382–92.

    КАС пабмед ПабМед Центральный Google ученый

  • Клингберг Э., Магнуссон М.К., Стрид Х., Демингер А., Шталь А., Сундин Дж. и др. Отличительный состав кишечной микробиоты у пациентов с анкилозирующим спондилитом связан с повышенным уровнем фекального кальпротектина. Артрит Res Ther. 2019;21:248.

    КАС пабмед ПабМед Центральный Google ученый

  • Falony G, Joossens M, Vieira-Silva S, Wang J, Darzi Y, Faust K, et al.Анализ вариаций микробиома кишечника на популяционном уровне. Наука. 2016; 352:560–4.

    КАС пабмед ПабМед Центральный Google ученый

  • Яцуненко Т.Р.Ф., Манари М.Дж., Трехан И., Домингес-Белло М.Г., Контрерас М., Магрис М. и др. Микробиом кишечника человека в зависимости от возраста и географии. Природа 2012; 486: 222–7.

    КАС пабмед ПабМед Центральный Google ученый

  • Биттингер К., Чжао С., Ли И., Форд Э., Фридман Э.С., Ни Дж. и др.Бактериальная колонизация перепрограммирует метаболом кишечника новорожденного. Нат микробиол. 2020;5:838–47.

    КАС пабмед ПабМед Центральный Google ученый

  • Вангай П., Уорд Т., Гербер Дж.С., Найтс Д. Антибиотики, детский дисбиоз и болезни. Клетка. Хост-микроб. 2015; 17: 553–64.

    КАС пабмед ПабМед Центральный Google ученый

  • Дешмукх Х.С., Лю Ю., Менкити О.Р., Мэй Дж., Дай Н., О’Лири К.Э. и др.Микробиота регулирует гомеостаз нейтрофилов и устойчивость хозяина к сепсису Escherichia coli K1 у новорожденных мышей. Нат Мед. 2014;20:524–30.

    КАС пабмед ПабМед Центральный Google ученый

  • Рукс М.Г., Гаррет В.С. Кишка. микробиота, метаболиты и иммунитет хозяина. Нат Рев Иммунол. 2016;16:341–52.

    КАС пабмед ПабМед Центральный Google ученый

  • Olszak T, An D, Zeissig S, Vera MP, Richter J, Franke A, et al.Воздействие микробов в раннем возрасте оказывает стойкое влияние на функцию Т-клеток естественных киллеров. Наука. 2012; 336: 489–93.

    КАС пабмед ПабМед Центральный Google ученый

  • Кокс Л.М., Яманиши С., Сон Дж., Алексеенко А.В., Леунг Дж.М., Чо И. и соавт. Изменение кишечной микробиоты во время критического окна развития имеет длительные метаболические последствия. Клетка. 2014; 158:705–21.

    КАС пабмед ПабМед Центральный Google ученый

  • Кимура И., Миямото Дж., Оуэ-Китано Р., Ватанабэ К., Ямада Т., Онуки М. и др.Микробиота кишечника матери во время беременности влияет на метаболический фенотип потомства у мышей. Наука. 2020;367:eaaw8429.

    КАС пабмед ПабМед Центральный Google ученый

  • Гордон Х.А., Пести Л. Гнотобиотическое животное как инструмент в изучении взаимоотношений микробов-хозяев. бактериол. 1971; 35: 390–429.

    КАС пабмед ПабМед Центральный Google ученый

  • Лучински П., Маквей Нойфельд К.А., Ориах К.С., Кларк Г., Динан Т.Г., Крайан Дж.Ф.Выращивание в пузыре: использование стерильных животных для оценки влияния кишечной микробиоты на мозг и поведение. Int J Neuropsychopharmacol. 2016;19:pyw020.

    ПабМед ПабМед Центральный Google ученый

  • Уилкс М. Бактерии и раннее развитие человека. Ранний Хам Дев. 2007; 83: 165–70.

    ПабМед ПабМед Центральный Google ученый

  • Gehrig JL, Venkatesh S, Chang HW, Hibberd MC, Kung VL, Cheng J, et al.Влияние пищевых продуктов, направленных на микробиоту, у гнотобиотических животных и недоедающих детей. Наука. 2019;365:eaau4732.

    ПабМед ПабМед Центральный Google ученый

  • Тернбо П.Дж., Лей Р.Е., Маховальд М.А., Магрини В., Мардис Э.Р., Гордон Д.И. Связанный с ожирением кишечный микробиом с повышенной способностью собирать энергию. Природа. 2006; 444:1027–31.

    ПабМед ПабМед Центральный Google ученый

  • Safari Z, Джерард П.Связь между кишечным микробиомом и неалкогольной жировой болезнью печени (НАЖБП). Клетка. Мол жизни Sci. 2019;76:1541–58.

    КАС пабмед ПабМед Центральный Google ученый

  • Jiang C, Li G, Huang P, Liu Z, Zhao B. Микробиота кишечника и болезнь Альцгеймера. Дж. Альцгеймера Дис. 2017; 58:1–15.

    ПабМед ПабМед Центральный Google ученый

  • Lee YP, Chiu CC, Lin TJ, Hung SW, Huang WC, Chiu CF, et al.Моноколонизация стерильных мышей Bacteroides fragilis улучшает колоректальный рак, вызванный азоксиметаном/декстрансульфатом натрия. Иммунофармакол Иммунотоксикол. 2019;41:207–13.

    КАС пабмед ПабМед Центральный Google ученый

  • Tissier H. Recherches sur la Flore кишечная де Nourrissons. C R Mem Soc Biol. 1899;51:943.

    Google ученый

  • Логан WR.Кишечная флора младенцев и детей раннего возраста. Джей Патол. 1913; 18: 527–51.

    Google ученый

  • Гарридо Д., Бариле Д., Миллс Д.А. Молекулярная основа обогащения бифидобактериями желудочно-кишечного тракта младенцев. Ад Нутр. 2012;3:415С–21С.

    КАС пабмед ПабМед Центральный Google ученый

  • Ruiz-Moyano S, Totten SM, Garrido DA, Smilowitz JT, German JB, Lebrilla CB и др.Различия в потреблении олигосахаридов грудного молока штаммами Bifidobacterium breve, связанными с кишечником младенцев. Appl Environ Microbiol. 2013;79:6040–9.

    КАС пабмед ПабМед Центральный Google ученый

  • Живкович А.М., Герман Д.Б., Лебрилла К.Б., Миллс Д.А. Гликобиом грудного молока и его влияние на микробиоту желудочно-кишечного тракта младенцев. Proc Natl Acad Sci USA. 2011; 108 (Приложение 1): 4653–8.

    КАС Google ученый

  • Хенрик Б.М., Хаттон А.А., Палумбо М.С., Касабури Г., Митчелл Р.Д., Андервуд М.А. и др.Повышенный рН кала указывает на глубокие изменения в микробиоме кишечника младенцев, находящихся на грудном вскармливании, из-за сокращения бифидобактерий за последнее столетие. мсфера. 2018;3:e00041–18.

    ПабМед ПабМед Центральный Google ученый

  • Литвак Ю., Биндлосс М.Х., Цолис Р.М., Баумлер А.Дж. Экспансия дисбиотических протеобактерий: микробный признак эпителиальной дисфункции. Curr Opin Microbiol. 2017; 39:1–6.

    КАС Google ученый

  • Милани С., Дюранти С., Боттачини Ф., Кейси Э., Туррони Ф., Махони Дж. и др.Первые микробные колонизаторы кишечника человека: состав, активность и последствия для здоровья кишечной микробиоты младенцев. Microbiol Mol Biol Rev. 2017;81:e00036–17.

    ПабМед ПабМед Центральный Google ученый

  • La Rosa PS, Warner BB, Zhou Y, Weinstock GM, Sodergren E, Hall-Moore CM, et al. Паттерн прогрессирования бактериальных популяций в кишечнике недоношенных детей. Proc Natl Acad Sci USA. 2014; 111:12522–7.

    Google ученый

  • Korpela K, Blakstad EW, Moltu SJ, Strommen K, Nakstad B, Ronnestad AE, et al.Развитие кишечной микробиоты и гестационный возраст у недоношенных новорожденных. Научный доклад 2018; 8: 2453.

    ПабМед ПабМед Центральный Google ученый

  • Ватанен Т., Плихта Д.Р., Сомани Дж., Мунк П.С., Артур Т.Д., Холл А.Б. и др. Геномная изменчивость и специфичная для штамма функциональная адаптация в микробиоме кишечника человека в раннем возрасте. Нат микробиол. 2019;4:470–9.

    КАС Google ученый

  • Раман А.С., Гериг Дж.Л., Венкатеш С., Чанг Х.В., Хибберд М.С., Субраманиан С. и др.Разреженная ковариантная единица, описывающая здоровое и нарушенное развитие кишечной микробиоты человека. Наука. 2019;365:eaau4735.

    ПабМед ПабМед Центральный Google ученый

  • Younge NE, Newgard CB, Cotten CM, Goldberg RN, Muehlbauer MJ, Bain JR, et al. Нарушение созревания микробиоты и метаболома у глубоконедоношенных детей с постнатальной задержкой роста. Научный доклад 2019; 9:8167.

    ПабМед ПабМед Центральный Google ученый

  • Liu J, Li Y, Feng Y, Pan L, Xie Z, Yan Z и др.Паттерн прогрессирования микробиоты кишечника, связанный с некротизирующим энтероколитом и поздним сепсисом у недоношенных детей: проспективное исследование в отделении интенсивной терапии новорожденных в Китае. Пир Дж. 2019;7:e7310.

    ПабМед ПабМед Центральный Google ученый

  • Галаццо Г., ван Бест Н., Бервоетс Л., Дапаах И.О., Савелкул П.Х., Хорнеф М.В. и др. Развитие микробиоты и связь со способом рождения, диетой и атопическими расстройствами в продольном анализе образцов стула, собранных с младенчества до раннего детства.Гастроэнтерология. 2020; 158: 1584–96.

    КАС Google ученый

  • Madan JC, Hoen AG, Lundgren SN, Farzan SF, Cottingham KL, Morrison HG, et al. Связь кесарева сечения и докорма молочной смесью с кишечным микробиомом 6-недельных детей. JAMA Педиатр. 2016;170:212–9.

    ПабМед ПабМед Центральный Google ученый

  • Stewart CJ, Ajami NJ, O’Brien JL, Hutchinson DS, Smith DP, Wong MC, et al.Временное развитие микробиома кишечника в раннем детстве по данным исследования TEDDY. Природа. 2018; 562: 583–8.

    КАС пабмед ПабМед Центральный Google ученый

  • Комбеллик Дж.Л., Шин Х., Шин Д., Кай Ю., Хаган Х., Лачер С. и др. Различия фекальной микробиоты новорожденных, родившихся дома и в роддоме. Научный доклад 2018; 8: 15660.

    ПабМед ПабМед Центральный Google ученый

  • Savage JH, Lee-Sarwar KA, Sordillo JE, Lange NE, Zhou Y, O’Connor GT, et al.Диета во время беременности и грудного возраста и кишечный микробиом младенцев. J Педиатр. 2018;203:47–54.e4.

    ПабМед ПабМед Центральный Google ученый

  • Лундгрен С.Н., Мадан Дж.К., Эмонд Дж.А., Моррисон Х.Г., Кристенсен Б.С., Карагас М.Р. и др. Питание матери во время беременности связано с микробиомом стула младенца в зависимости от способа родоразрешения. Микробиом. 2018;6:109.

    ПабМед ПабМед Центральный Google ученый

  • Williams JE, Carrothers JM, Lackey KA, Beatty NF, Brooker SL, Peterson HK, et al.Между молочным, оральным и фекальным микробиомами в диадах мать-младенец в течение первых шести месяцев после родов существуют сильные многомерные отношения. Дж Нутр. 2019; 149: 902–14.

    ПабМед ПабМед Центральный Google ученый

  • Азад М.Б., Конья Т., Персо Р.Р., Гуттман Д.С., Чари Р.С., Филд С.Дж. и др. Влияние материнских интранатальных антибиотиков, способа родов и грудного вскармливания на микробиоту кишечника в течение первого года жизни: проспективное когортное исследование.Int J Obstet Gynaecol. 2016; 123:983–93.

    КАС Google ученый

  • Coker MO, Hoen AG, Dade E, Lundgren S, Li Z, Wong AD, et al. Конкретный класс интранатальных антибиотиков связан с созреванием микробиоты кишечника младенцев: проспективное когортное исследование. Int J Obstet Gynaecol. 2020; 127: 217–27.

    КАС Google ученый

  • Eck A, Rutten N, Singendonk MMJ, Rijkers GT, Savelkoul PHM, Meijssen CB и др.Развитие микробиоты новорожденных и действие антибиотиков в раннем возрасте определяются двумя различными типами поселенцев. ПЛОС ОДИН. 2020;15:e0228133.

    КАС пабмед ПабМед Центральный Google ученый

  • Гупта Р.В., Л. Тран, Дж. Норори, М.Дж. Феррис, А.М. Эрен, С.М. Тейлор и др. Блокаторы рецепторов гистамина-2 изменяют фекальную микробиоту у недоношенных детей. J Pediatr Gastroenterol Nutr. 2013; 56: 397–400.

    КАС Google ученый

  • Леви Э.И., Хоанг Д.М., Ванденплас Ю.Влияние ингибиторов протонной помпы на микробиом у детей раннего возраста. Акта Педиатр. 2020;109:1531–8.

    КАС Google ученый

  • Vich Vila A, Collij V, Sanna S, Sinha T, Imhann F, Bourgonje AR, et al. Влияние часто используемых лекарств на состав и метаболическую функцию кишечной микробиоты. Нац коммун. 2020;11:362.

    КАС пабмед ПабМед Центральный Google ученый

  • Джексон М.А., Верди С., Максан М.Е., Шин С.М., Цирер Дж., Бойер Р.С.Э. и др.Связь кишечной микробиоты с распространенными заболеваниями и отпускаемыми по рецепту лекарствами в популяционной когорте. Нац коммун. 2018;9:2655.

    ПабМед ПабМед Центральный Google ученый

  • Iszatt N, Janssen S, Lenters V, Dahl C, Stigum H, Knight R, et al. Экологические токсиканты в грудном молоке норвежских матерей и состав и метаболиты кишечных бактерий у их младенцев в возрасте 1 месяца. Микробиом 2019; 7:34.

    ПабМед ПабМед Центральный Google ученый

  • Лауэ Х.Е., Мороиши Ю., Джексон Б.П., Палыс Т.Дж., Мадан Д.К., Карагас М.Р.Смеси питательных веществ и токсичных элементов и микробиом кишечника в раннем послеродовом периоде в продольной когорте новорожденных в США. Окружающая среда Интерн. 2020;138:105613.

    КАС Google ученый

  • McLean C, Jun S, Kozyrskyj A. Влияние курения матери на микробиоту кишечника младенца и его связь с избыточным весом ребенка: предварительный обзор. Мир J Педиатр. 2019;15:341–9.

    Google ученый

  • Tun HM, Konya T, Takaro TK, Brook JR, Chari R, Field CJ, et al.Воздействие домашних пушистых питомцев влияет на микробиоту кишечника младенцев в возрасте 3-4 месяцев при различных сценариях родов. Микробиом. 2017;5:40.

    ПабМед ПабМед Центральный Google ученый

  • Д’Агата А.Л., Ву Дж., Веландаве М.К.В., Дутра С.В.О., Кейн Б., Гроер М.В. Влияние стресса в отделении интенсивной терапии в раннем возрасте на развивающийся микробиом кишечника. Дев Психобиолог. 2019;61:650–60.

    ПабМед ПабМед Центральный Google ученый

  • Хо ТТБ, Гроер М.В., Кейн Б., Йи А.Л., Торрес Б.А., Гилберт Дж.А. и др.Дихотомическое развитие микробиома кишечника у недоношенных детей. Микробиом. 2018;6:157.

    ПабМед ПабМед Центральный Google ученый

  • Парра-Льорка А., Гормаз М., Алькантара С., Сернада М., Нуньес-Рамиро А., Венто М. и др. Микробиом кишечника недоношенных в зависимости от типа вскармливания: значение донорского грудного молока. Фронт микробиол. 2018;9:1376.

    ПабМед ПабМед Центральный Google ученый

  • Тафт Д.Х., Салинеро Л.К., Вонгбхавит К., Каланетра К.М., Масарве С., Ю.А. и др.Бактериальная колонизация и гены устойчивости к противомикробным препаратам в зондах для энтерального питания новорожденных. FEMS Microbiol Ecol. 2019;95:физ039.

    КАС пабмед ПабМед Центральный Google ученый

  • Ногацка А., Салазар Н., Суарес М., Милани С., Арболея С., Солис Г. и др. Влияние интранатальной антимикробной профилактики на кишечную микробиоту и распространенность генов устойчивости к антибиотикам у доношенных новорожденных, родившихся естественным путем.Микробиом. 2017;5:93.

    ПабМед ПабМед Центральный Google ученый

  • Гаспаррини А.Дж., Крофтс Т.С., Гибсон М.К., Тарр П.И., Уорнер Б.Б., Дантас Г. Нарушение антибиотиками кишечного микробиома и резистома недоношенных детей. Кишечные микробы. 2016;7:443–9.

    КАС пабмед ПабМед Центральный Google ученый

  • Гибсон М.К., Ван Б., Ахмади С., Бернхэм К.А., Тарр П.И., Уорнер Б.Б. и др.Динамика развития микробиоты кишечника недоношенных детей и антибиотикорезистом. Нат микробиол. 2016;1:16024.

    КАС пабмед ПабМед Центральный Google ученый

  • Rutayisire E, Huang K, Liu Y, Tao F. Способ родоразрешения влияет на разнообразие и характер колонизации микробиоты кишечника в течение первого года жизни младенцев: систематический обзор. БМК Гастроэнтерол. 2016;16:86.

    ПабМед ПабМед Центральный Google ученый

  • Dahl C, Stigum H, Valeur J, Iszatt N, Lenters V, Peddada S, et al.Недоношенные дети имеют различные микробиомы, которые не объясняются способом родоразрешения, продолжительностью грудного вскармливания или воздействием антибиотиков. Int J Эпидемиол. 2018;47:1658–69.

    ПабМед ПабМед Центральный Google ученый

  • Тун М.Х., Тун Х.М., Махони Дж.Дж., Конья Т.Б., Гуттман Д.С., Беккер А.Б. и другие. Постнатальное воздействие бытовых дезинфицирующих средств, микробиота кишечника младенцев и последующий риск избыточного веса у детей. Can Med Assoc J. 2018;190:E1097–e107.

    Google ученый

  • Шоу К.А., Берта М., Хофмеклер Т., Чопра П., Ватанен Т., Сриватса А. и др. Дисбактериоз, воспаление и ответ на лечение: лонгитюдное исследование педиатрических субъектов с недавно диагностированным воспалительным заболеванием кишечника. Геном Мед. 2016;8:75.

    ПабМед ПабМед Центральный Google ученый

  • Xia GH, You C, Gao XX, Zeng XL, Zhu JJ, Xu KY и др.Индекс дисбиоза инсульта (SDI) в микробиоме кишечника связан с повреждением головного мозга и прогнозом инсульта. Фронт Нейрол. 2019;10:397.

    ПабМед ПабМед Центральный Google ученый

  • Guo Y, Zhang Y, Gerhard M, Gao JJ, Mejias-Luque R, Zhang L, et al. Влияние Helicobacter pylori на микробиоту желудочно-кишечного тракта: популяционное исследование в Линцю, районе высокого риска рака желудка. Кишка. 2019. https://doi.org/10.1136/gutjnl-2019-319696.

  • Casen C, Vebo HC, Sekelja M, Hegge FT, Karlsson MK, Ciemniejewska E, et al. Отклонения в микробиоте кишечника человека: новый диагностический тест для определения дисбактериоза у пациентов с СРК или ВЗК. Пищевая фармакотерапия. 2015;42:71–83.

    КАС Google ученый

  • Mandl T, Marsal J, Olsson P, Ohlsson B, Andreasson K. Тяжелый дисбактериоз кишечника преобладает при первичном синдроме Шегрена и связан с активностью системного заболевания.Артрит Res Ther. 2017;19:237.

    ПабМед ПабМед Центральный Google ученый

  • Ватанен Т., Костич А.Д., д’Хеннезель Э., Силжандер Х., Францоза Э.А., Яссур М. и др. Изменение иммуногенности ЛПС микробиома способствует аутоиммунитету у людей. Клетка. 2016; 165:842–53.

    КАС пабмед ПабМед Центральный Google ученый

  • Ватанен Т., Францоса Э.А., Швагер Р., Трипати С., Артур Т.Д., Вехик К. и др.Микробиом кишечника человека при диабете 1 типа с ранним началом из исследования TEDDY. Природа. 2018; 562: 589–94.

    КАС пабмед ПабМед Центральный Google ученый

  • Chua HH, Chou HC, Tung YL, Chiang BL, Liao CC, Liu HH и др. Дисбиоз кишечника с обилием ruminococcus gnavus ассоциирован с аллергическими заболеваниями у детей раннего возраста. Гастроэнтерология. 2018; 154:154–67.

    ПабМед ПабМед Центральный Google ученый

  • Lee MJ, Kang MJ, Lee SY, Lee E, Kim K, Won S и др.Нарушения генов кишечного микробиома у детей раннего возраста с атопическим дерматитом в зависимости от типа вскармливания. J Аллергия Клин Иммунол. 2018; 141:1310–9.

    КАС пабмед ПабМед Центральный Google ученый

  • Lamont RF, Moller Luef B, Stener Jorgensen J. Детские воспалительные и метаболические заболевания после воздействия антибиотиков во время беременности, антенатально, интранатально и неонатально. F1000рез. 2020;9:144.

    Google ученый

  • Дохауэр Карпа К., Пол И.М., Леки Дж.А., Шунг С., Каркачи-Салли Н., Врана К.Е. и др.Ретроспективный обзор карт для выявления перинатальных факторов, связанных с пищевой аллергией. Нутр Дж. 2012;11:87.

    ПабМед ПабМед Центральный Google ученый

  • Мец Т.Д., МакКинни Дж., Оллсхаус А.А., Книрим С.Д., Кэри Д.К., Хейборн К.Д. Воздействие стрептококковой антибиотикопрофилактики группы B и индекс массы тела в раннем детстве в когорте вагинальных рождений. J Matern Fetal Neonatal Med. 2020;33:3318–3323.

    ПабМед ПабМед Центральный Google ученый

  • Воль Д.Л., Карри В.Дж., Могер Д., Миллер Дж., Тайри К.Интранатальные антибиотики и детский атопический дерматит. J Am Board Fam Med. 2015;28:82–9.

    ПабМед ПабМед Центральный Google ученый

  • Памми М., Коуп Дж., Тарр П.И., Уорнер Б.Б., Морроу А.Л., Май В. и др. Дисбактериоз кишечника у недоношенных детей, предшествующий некротизирующему энтероколиту: систематический обзор и метаанализ. Микробиом. 2017;5:31.

    ПабМед ПабМед Центральный Google ученый

  • Olm MR, Bhattacharya N, Crits-Christoph A, Firek BA, Baker R, Song YS, et al.Некротизирующему энтероколиту предшествует повышенная репликация кишечных бактерий, клебсиеллы и бактерии, кодирующие фимбрии. Научная реклама 2019;5:eaax5727.

    КАС пабмед ПабМед Центральный Google ученый

  • Esmaeilizand R, Shah PS, Seshia M, Yee W, Yoon EW, Dow K. Воздействие антибиотиков и развитие некротизирующего энтероколита у очень недоношенных новорожденных. Педиатр Здоровье ребенка. 2018;23:e56–e61.

    ПабМед ПабМед Центральный Google ученый

  • Эсайассен Э., Фьялстад Дж.В., Ювет Л.К., ван ден Анкер Дж.Н., Клингенберг К.Воздействие антибиотиков на новорожденных и ранние неблагоприятные исходы: систематический обзор и метаанализ. J Антимикроб. Чемотер. 2017; 72: 1858–70.

    КАС пабмед ПабМед Центральный Google ученый

  • Guillet R, Stoll BJ, Cotten CM, Gantz M, McDonald S, Poole WK, et al. Ассоциация терапии блокаторами Н3 и более высокой частотой некротизирующего энтероколита у новорожденных с очень низкой массой тела при рождении. Педиатрия. 2006; 117:e137–42.

    ПабМед Google ученый

  • Хьюитт К.М., Маннино Ф.Л., Гонсалес А., Чейз Дж.Х., Капорасо Дж.Г., Найт Р. и др.Бактериальное разнообразие в двух отделениях интенсивной терапии новорожденных (ОИТН). ПЛОС ОДИН. 2013;8:e54703.

    КАС пабмед ПабМед Центральный Google ученый

  • Бокулич Н.А., Миллс Д.А., Андервуд М.А. Поверхностные микробы в отделении интенсивной терапии новорожденных: изменения при обычной уборке и с течением времени. Дж. Клин Микробиол. 2013;51:2617–24.

    ПабМед ПабМед Центральный Google ученый

  • Брукс Б., Олм М.Р., Фирек Б.А., Бейкер Р., Геллер-МакГрат Д., Реймер С.Р. и др.Развивающийся кишечный микробиом недоношенных детей является основным фактором, формирующим микробиом отделений интенсивной терапии новорожденных. Микробиом. 2018;6:112.

    ПабМед ПабМед Центральный Google ученый

  • Stewart CJ, Embleton ND, Marrs ECL, Smith DP, Fofanova T, Nelson A, et al. Продольное развитие кишечного микробиома и метаболома у недоношенных новорожденных с поздним началом сепсиса и здоровых контролей. Микробиом. 2017;5:75.

    ПабМед ПабМед Центральный Google ученый

  • Singer JR, Blosser EG, Zindl CL, Silberger DJ, Conlan S, Laufer VA, et al. Профилактика дисбиоза кишечного микробиома новорожденных мышей защищает от позднего сепсиса. Нат Мед. 2019;25:1772–82.

    КАС пабмед ПабМед Центральный Google ученый

  • Маси А.С., Стюарт С.Дж. Роль кишечного микробиома недоношенных при сепсисе и некротическом энтероколите.Ранний Хам Дев. 2019;138:104854.

    ПабМед ПабМед Центральный Google ученый

  • Hemmi MH, Wolke D, Schneider S. Связь между проблемами плача, сна и/или кормления в младенчестве и долгосрочными поведенческими результатами в детстве: метаанализ. Арч Дис Чайлд. 2011;96:622–9.

    ПабМед ПабМед Центральный Google ученый

  • Loughman A, Quinn T, Nation ML, Reichelt A, Moore RJ, Van TTH, et al.Младенческая микробиота при коликах: прогностические ассоциации с проблемным плачем и последующим поведением ребенка. J Dev Orig Health Dis. 2020: 1–11. https://doi.org/10.1017/S2040174420000227.

  • Хаттенхауэр С., Костич А.Д., Ксавье Р.Дж. Воспалительные заболевания кишечника как модель трансляции микробиома. Иммунитет. 2014;40:843–54.

    КАС пабмед ПабМед Центральный Google ученый

  • Майер Э.А., Тиллиш К., Гупта А.Ось кишечник/мозг и микробиота. Дж. Клин Инвестиг. 2015; 125:926–38.

    ПабМед ПабМед Центральный Google ученый

  • Honda K, Littman DR. Микробиота в адаптивном иммунном гомеостазе и заболеваниях. Природа. 2016; 535:75–84.

    КАС пабмед ПабМед Центральный Google ученый

  • Schroeder BO, Bäckhed F. Сигналы микробиоты кишечника к отдаленным органам в физиологии и заболеваниях.Нат Мед. 2016;22:1079–89.

    КАС пабмед ПабМед Центральный Google ученый

  • Леви М., Колодзейчик А.А., Таисс К.А., Элинав Э. Дисбактериоз и иммунная система. Нат Рев Иммунол. 2017;17:219–32.

    КАС пабмед ПабМед Центральный Google ученый

  • Марувада П., Леоне В., Каплан Л.М., Чанг Э.Б. Микробиом человека и ожирение: выход за рамки ассоциаций.Клетка. Хост-микроб. 2017;22:589–99.

    КАС пабмед ПабМед Центральный Google ученый

  • Бах И.Ф. Гигиеническая гипотеза в аутоиммунитете: роль патогенов и комменсалов. Нат Рев Иммунол. 2018;18:105–20.

    КАС пабмед ПабМед Центральный Google ученый

  • Браун Дж.М., Хазен С.Л. Микробная модуляция сердечно-сосудистых заболеваний. Нат преп.2018;16:171–81.

    КАС Google ученый

  • Tilg H, Zmora N, Adolph TE, Elinav E. Кишечная микробиота, подпитывающая метаболическое воспаление. Нат Рев Иммунол. 2020;20:40–54.

    КАС пабмед ПабМед Центральный Google ученый

  • Якоб С., Якоб Д.Г. Инфекционные угрозы, кишечный барьер и его троянский конь: дисбактериоз. Фронт микробиол. 2019;10:1676.

    ПабМед ПабМед Центральный Google ученый

  • Fouhse JM, Yang K, More-Bayona J, Gao Y, Goruk S, Plastow G, et al. Неонатальное воздействие амоксициллина изменяет долговременный иммунный ответ, несмотря на временное воздействие на микробиоту кишечника у поросят. Фронт Иммунол. 2019;10:2059.

    КАС пабмед ПабМед Центральный Google ученый

  • Бомонт М., Паес С., Муссар Э., Кнудсен С., Кокил Л., Аймар П. и др.Метаболиты кишечной микробиоты способствуют созреванию кишечного барьера при переходе от грудного вскармливания к отъему. Кишечные микробы. 2020; 11: 1268–86.

    ПабМед ПабМед Центральный Google ученый

  • Suh SH, Choe K, Hong SP, Jeong SH, Mäkinen T, Kim KS, et al. Микробиота кишечника регулирует целостность молочной железы, индуцируя VEGF-C в макрофагах кишечных ворсинок. EMBO Rep. 2019; 20:e46927.

    ПабМед ПабМед Центральный Google ученый

  • Кулкарни Д.Х., Макдональд К.Г., Кнуп К.А., Густафссон Дж.К., Козловски К.М., Хунстад Д.А. и др.Пассажи антигена, связанные с бокаловидными клетками, ингибируются во время инфекции Salmonella typhimurium, чтобы предотвратить распространение патогена и ограничить реакцию на пищевые антигены. Иммунол слизистых оболочек. 2018;11:1103–13.

    КАС пабмед ПабМед Центральный Google ученый

  • Abo ​​H, Chassaing B, Harusato A, Quiros M, Brazil JC, Ngo VL, et al. Регулятор дифференцировки эритроидов-1, индуцируемый микробиотой в раннем возрасте, стимулирует пролиферацию и регенерацию стволовых клеток кишечника.Нац коммун. 2020;11:513.

    КАС пабмед ПабМед Центральный Google ученый

  • Fung TC, Vuong HE, Luna CDG, Pronovost GN, Александрова AA, Riley NG, et al. Воздействие серотонина и флуоксетина на кишечник модулирует бактериальную колонизацию в кишечнике. Нат микробиол. 2019;4:2064–73.

    ПабМед ПабМед Центральный Google ученый

  • Canfora EE, Meex RCR, Venema K, Blaak EE.Метаболиты микроорганизмов кишечника при ожирении, НАЖБП и СД2. Обзоры природы. Эндокринология. 2019;15:261–73.

    КАС пабмед ПабМед Центральный Google ученый

  • Лау В.Л., Вазири Н.Д. Жирные кислоты с короткой цепью микробов кишечника и риск диабета. Нат Рев Нефрол. 2019;15:389–90.

    ПабМед ПабМед Центральный Google ученый

  • Санна С., ван Зуйдам Н.Р., Махаджан А., Курильщиков А., Вич Вила А., Воса У. и др.Причинно-следственные связи между кишечным микробиомом, короткоцепочечными жирными кислотами и метаболическими заболеваниями. Нат Жене. 2019;51:600–5.

    КАС пабмед ПабМед Центральный Google ученый

  • Де Ваддер Ф., Ковачева-Дачари П., Гонсалвес Д., Винера Дж., Зитун С., Дюшам А. и другие. Метаболиты, генерируемые микробиотой, способствуют метаболическим преимуществам через нервные цепи кишечника и головного мозга. Клетка. 2014; 156:84–96.

    ПабМед ПабМед Центральный Google ученый

  • Далиле Б., Ван Ауденхове Л., Вервлит Б., Вербеке К.Роль короткоцепочечных жирных кислот в коммуникации микробиота-кишечник-мозг. Нат Рев Гастроэнтерол Гепатол. 2019;16:461–78.

    ПабМед ПабМед Центральный Google ученый

  • Parada Venegas D, De la Fuente MK, Landskron G, Gonzalez MJ, Quera R, Dijkstra G, et al. Опосредованная короткоцепочечными жирными кислотами (SCFAs) эпителиальная и иммунная регуляция кишечника и ее значение для воспалительных заболеваний кишечника. Фронт Иммунол. 2019;10:277.

    ПабМед ПабМед Центральный Google ученый

  • Frese SA, Hutton AA, Contreras LN, Shaw CA, Palumbo MC, Casaburi G, et al.Стойкость добавок Bifidobacterium longum subsp. infantis EVC001 у младенцев, находящихся на грудном вскармливании. мсфера. 2017;2:e00501–17.

    ПабМед ПабМед Центральный Google ученый

  • Чжэн Н., Гао Ю., Чжу В., Мэн Д., Уокер В. А. Короткоцепочечные жирные кислоты, продуцируемые при взаимодействии колонизирующих кишечных комменсальных бактерий со сцеженным грудным молоком, оказывают противовоспалительное действие на незрелые энтероциты человека. ПЛОС ОДИН. 2020;15:e0229283.

    КАС пабмед ПабМед Центральный Google ученый

  • Waligora-Dupriet AJ, Dugay A, Auzeil N, Nicolis I, Rabot S, Huerre MR, et al. Короткоцепочечные жирные кислоты и полиамины в патогенезе некротического энтероколита: аспекты кинетики у гнотобиотических перепелов. Анаэроб. 2009; 15:138–44.

    КАС пабмед ПабМед Центральный Google ученый

  • Рой С.К., Мэн К., Садовиц Б.Д., Коллиш-Сингул М., Йепури Н., Саталин Дж. и др.Энтеральное введение смеси, ферментированной бактериями, у новорожденных поросят: высокоточная модель некротизирующего энтероколита (НЭК). ПЛОС ОДИН. 2018;13:e0201172.

    ПабМед ПабМед Центральный Google ученый

  • Менг Д., Соммелла Э., Сальвиати Э., Кампилья П., Гангули К., Джебали К. и др. Индол-3-молочная кислота, метаболит триптофана, секретируемый Bifidobacterium longum подвида infantis, оказывает противовоспалительное действие в незрелом кишечнике.Педиатр Рез. 2020 г. https://doi.org/10.1038/s41390-019-0740-x.

  • Мухопадхьяй С., Уэйд К.С., Пуополо К.М. Препараты для профилактики и лечения сепсиса у новорожденных. Клин Перинатол. 2019;46:327–47.

    ПабМед ПабМед Центральный Google ученый

  • Кабальеро-Флорес Г., Сакамото К., Зенг М.Ю., Ван Ю., Хаким Дж., Матус-Акунья В. и др. Иммунизация матери обеспечивает защиту потомства от прикрепляющегося и исчезающего патогена за счет доставки IgG в грудное молоко.Клетка. Хост-микроб. 2019;25:313–23.e4.

    КАС пабмед ПабМед Центральный Google ученый

  • Мухопадхьяй С., Сенгупта С., Пуополо К.М. Проблемы и возможности рационального использования антибиотиков у недоношенных детей. Арч Дис Чайлд. 2019;104:F327–f32.

    Google ученый

  • Шульман Дж., Диманд Р.Дж., Ли Х.К., Дуэнас Г.В., Беннетт М.В., Гулд Дж.Б. Применение антибиотиков в отделении интенсивной терапии новорожденных.Педиатрия. 2015; 135:826–33.

    ПабМед ПабМед Центральный Google ученый

  • Schulman J, Profit J, Lee HC, Duenas G, Bennett MV, Parucha J, et al. Варианты применения антибиотиков у новорожденных. Педиатрия. 2018;142:e20180115.

    ПабМед ПабМед Центральный Google ученый

  • Chi C, Buys N, Li C, Sun J, Yin C. Влияние пребиотиков на сепсис, некротизирующий энтероколит, смертность, непереносимость питания, время до полного энтерального питания, продолжительность пребывания в больнице и частоту стула у недоношенных детей : метаанализ.Eur J Clin Nutr. 2019; 73: 657–70.

    КАС пабмед ПабМед Центральный Google ученый

  • Sun J, Marwah G, Westgarth M, Buys N, Ellwood D, Gray PH. Влияние пробиотиков на некротизирующий энтероколит, сепсис, внутрижелудочковое кровоизлияние, смертность, продолжительность пребывания в больнице и увеличение веса у глубоко недоношенных детей: метаанализ. Ад Нутр. 2017; 8: 749–63.

    ПабМед ПабМед Центральный Google ученый

  • Дешпанде Г., Джейп Г., Рао С., Патоле С.Преимущества пробиотиков у недоношенных новорожденных в странах с низким и средним уровнем дохода: систематический обзор рандомизированных контролируемых исследований. Открытый БМЖ. 2017;7:e017638.

    ПабМед ПабМед Центральный Google ученый

  • Дермиши Э., Ван Ю., Ян С., Хун В., Цю Г., Гонг Х. и др. «Золотой век» пробиотиков: систематический обзор и метаанализ рандомизированных и обсервационных исследований у недоношенных детей. Неонатология. 2017; 112:9–23.

    КАС пабмед ПабМед Центральный Google ученый

  • Olsen R, Greisen G, Schroder M, Brok J. Профилактические пробиотики для недоношенных детей: систематический обзор и метаанализ обсервационных исследований. Неонатология. 2016;109:105–12.

    ПабМед ПабМед Центральный Google ученый

  • Kuang L, Jiang Y. Влияние пробиотических добавок на беременных женщин: метаанализ рандомизированных контролируемых исследований.Бр Дж Нутр. 2020; 123: 870–80.

    КАС Google ученый

  • Skonieczna-Zydecka K, Janda K, Kaczmarczyk M, Marlicz W, Loniewski I, Loniewska B. Влияние пробиотиков на симптомы, микробиоту кишечника и маркеры воспаления при младенческих коликах: систематический обзор, метаанализ и метаанализ регресс рандомизированных контролируемых исследований. Дж. Клин Мед. 2020;9:999.

    КАС Google ученый

  • ТЭЦ ван ден Аккер, ван Гудовер Дж. Б., Шамир Р., Домеллоф М., Эмблетон Н. Д., Хойсак И. и др.Пробиотики и недоношенные дети: документ с изложением позиции комитета по гепатологии и питанию Европейского общества детской гастроэнтерологии и рабочей группы Европейского общества детской гастроэнтерологии по гепатологии и питанию по пробиотикам и пребиотикам. J Pediatr Gastroenterol Nutr. 2020; 70: 664–80.

    Google ученый

  • ТЭЦ ван ден Аккер, ван Гудовер Дж. Б., Шаевска Х., Эмблтон Н. Д., Хойсак И., Рейд Д. и др.Пробиотики для недоношенных детей: систематический обзор штаммов и сетевой метаанализ. J Pediatr Gastroenterol Nutr. 2018;67:103–22.

    Google ученый

  • Su GL, Ko CW, Bercik P, Falck-Ytter Y, Sultan S, Weizman AV, et al. Клинические рекомендации AGA по роли пробиотиков в лечении желудочно-кишечных расстройств. Гастроэнтерология. 2020 г. https://doi.org/10.1053/j.gastro.2020.05.059.

  • Lewis ZT, Shani G, Masarweh CF, Popovic M, Frese SA, Sela DA, et al.Проверка идентичности видов и подвидов бифидобактерий в коммерческих пробиотических продуктах. Педиатр Рез. 2016;79:445–52.

    КАС Google ученый

  • Чианг М.С., Чен К.Л., Фэн И., Чен К.С., Лиен Р., Чиу Ч. Lactobacillus rhamnosus сепсис, связанный с терапией пробиотиками у крайне недоношенных детей: патогенез и обзор для клиницистов. J Microbiol Immunol Infect. 2020. https://doi.org/10.1016/j.jmii.2020.03.029

  • Пелл Л.Г., Луте М.Г., Рот Д.Е., Шерман П.М. Аргументы против рутинного приема пробиотиков для профилактики НЭК. Курр Опин Педиатрия. 2019;31:195–201.

    Google ученый

  • Микробный дисбактериоз тонкой кишки лежит в основе симптомов, связанных с функциональными желудочно-кишечными расстройствами

    Этическое одобрение исследований на людях

    Все исследования на людях были одобрены IRB клиники Майо [тестовые образцы (16–006388 и 15–003235), здоровые контроли (14 –002382 и 15–003603)], и мы соблюдали все соответствующие этические нормы.Исследование диетического вмешательства было зарегистрировано на сайте ClinicalTrials.gov (NCT03266536). Все участники диетического исследования дали информированное согласие, в то время как аспираты тонкой кишки были получены в лаборатории клинической микробиологии в соответствии с отказом от согласия IRB для протокола 15-003235. Биологические материалы, полученные от пациентов, не могут быть переданы на основании протокола, утвержденного институциональным IRB.

    Сбор аспиратов тонкой кишки

    Последовательные образцы аспиратов тонкой кишки от пациентов с симптомами после диагностической ЭГДС были получены непосредственно в микробиологической лаборатории с мая 2016 г. по декабрь 2016 г.Образцы аспирата двенадцатиперстной кишки были собраны во время ЭГДС после прямого прохода в двенадцатиперстную кишку с минимальным надуванием в желудке с использованием стандартного однопросветного аспирационного катетера, пропущенного через аспирационное отверстие эндоскопа. Были включены образцы, связанные с пациентами, которые ранее дали согласие на просмотр электронной медицинской карты. Всего за этот промежуток времени было получено 143 аспирата от пациентов с симптомами. После исключения образцов из-за отсутствия согласия или низкой глубины чтения при секвенировании (< 1000) было включено в общей сложности 126 пациентов с симптомами.Аспираты двенадцатиперстной кишки, полученные от 38 здоровых добровольцев, участвовавших в других исследованиях, и собранные аналогичным образом, также были получены и обработаны аналогичным образом. Клинические метаданные были получены путем ретроспективного просмотра электронной медицинской карты, включая демографическую информацию, ИМТ, клинические показания для тестирования на SIBO, количественные результаты аэробных и анаэробных аспирационных культур, курс антибиотиков для лечения SIBO, клинический ответ на антибиотики, потребность в повторных антибиотиках, недавние лекарства. включая использование антибиотиков и ИПП, операции на желудочно-кишечном тракте, сопутствующие заболевания и т. д.

    Критерии диагностики СИБР на основе количественных посевов

    Аспираты тонкой кишки (10  мкл) засевают на RBAP (кровяной агар), REMB (грамотрицательная селекционная среда), RBAPA (предварительно восстановленный кровяной агар) и инкубируют в аэробных условиях при 35 °C, 5% CO 2 , RIMA (селективная среда для дрожжей) и инкубация при комнатной температуре и на RCDC (анаэробный кровяной агар), RLKC (озеренная кровь, канамицин, ванкомицин — Prevotella , селекция), RPEA (феноло-спиртовой агар — грамположительные селективные) и инкубируют в анаэробных условиях либо в клинической лаборатории, либо в исследовательской лаборатории.Общее количество бактерий (анаэробные плюс аэробные) было меньше или больше 10 5 КОЕ/мл, а диагноз SIBO был основан на культуре аспирата двенадцатиперстной кишки, демонстрирующей  ≥ 10 5 КОЕ/мл роста бактерий (аэробных, анаэробных). , или оба) более 48 часов 15,16,17 .

    Сравнение культур и секвенирования 16S рРНК

    Бактериальную ДНК экстрагировали из аспиратов и биоптатов двенадцатиперстной кишки с использованием фенол-хлороформа и из кала с помощью набора для экстракции фекальной ДНК MoBio с последующей амплификацией 16 S рРНК с использованием совместимых с библиотекой Nextera праймеров, фланкирующих V4 гипервариабельную область ([прямой выступ] + 515 F: [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]GTGCCAGCMGCCGCGGTAA; и [обратный выступ] + 806 R: [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]GGACTACHVGGGTWTCTAAT) и подготовили для секвенирования с использованием протокола dual 4.8-8-8-index.94.Все образцы были секвенированы вместе в режиме 2 × 300 парных концов на приборе Illumina MiSeq с использованием реагентов v3 Центра геномики Университета Миннесоты.

    Необработанные последовательности с парными концами были отфильтрованы по качеству, обрезаны адаптером и сшиты с использованием конвейера контроля качества SHI7 35 с порогом обрезки  > 32 и средним показателем качества > 35. с ускоренным механизмом выравнивания с оптимальным зазором BURST 36,37 в режиме CAPITALIST по бактериальным и архейным базам данных 16 S проекта NCBI RefSeq Targeted Loci Project (https://www.ncbi.nlm.nih.gov/refseq/targetedloci/) с 97-процентной идентичностью. После фильтрации образцов с низкой глубиной считывания мы приступили к анализу 126 пациентов с симптомами и 38 здоровых людей из контрольной группы. Анализ разнообразия был выполнен с использованием QIIME v1.9.1 38 , а анализ других данных, статистические тесты и визуализация были выполнены в R. Чтобы сравнить разнообразие различных типов образцов желудочно-кишечного тракта в исследовании диетического вмешательства, последовательности были разрежены до средней глубины. сайта с наименьшим количеством чтений, CLR (центрированное логарифмическое отношение) — преобразовано после мультипликативной замены и проанализировано с помощью пользовательских сценариев R и пакета «веган » .

    Дифференциальный анализ численности между здоровыми и симптомными субъектами был выполнен на основе нормализованных данных численности 39 в каждом таксономическом ранге с использованием теста перестановок (1000 перестановок) с t-статистикой в ​​качестве статистики теста. Перед тестированием к нормализованным данным о численности применяли преобразование квадратного корня. Таксоны с распространенностью  < 10% или максимальной долей < 0,2% исключались из тестирования. Контроль FDR (процедура Бенджамини-Хохберга) выполнялся для каждого таксономического ранга, чтобы скорректировать множественное тестирование.SI был сгенерирован с использованием классификации случайных лесов на основе нормализованных данных уровня OTU (пакет «randomForest» в R). Шкала индекса была определена как неверная вероятность классификации пациентов с симптомами на основе сгенерированной модели. Этот метод предотвращает переобучение, удерживая выборку для классификации и прогнозируя на основе оставшихся n -1 наборов данных. Функция выбора Boruta 40 (пакет Boruta в R) использовалась для определения OTU, которые вносят значительный вклад в классификацию.Связи с семью демографическими или клиническими переменными были проверены с использованием моделей линейной регрессии и скорректированы для множественного тестирования с использованием контроля FDR.

    Мы сгенерировали DI, используя метод CLOUD 24 . Вкратце, матрица расстояний Эйтчисона для здоровых образцов использовалась в качестве эталонного облака, и расстояние от каждого здорового образца до здорового облака рассчитывалось для каждого образца в наборе данных. Этот расчет расстояния был затем повторен для каждого образца пациента с симптомами относительно здорового облака; расстояния, превышающие два стандартных отклонения (SD) от среднего значения здорового расстояния, считаются «дисбиотическими»; те, которые находятся в пределах 2 SD от среднего значения здорового расстояния, считаются «здоровыми».Затем эта оценка дисбактериоза CLOUD была подтверждена с использованием ортогонального подхода, основанного на показателях SI: мы подгоняем показатели SI здоровых людей к распределению по логит-шкале (значения SI здорового контроля приблизительно нормальны по логит-шкале; p  = 0,41, нормальность Шапиро-Уилка контрольная работа). Мы снова применили правило 2 SD, классифицировав образцы, превышающие 2 SD, от среднего значения здорового распределения как «дисбиотические», а образцы в пределах 2 SD — как «похожие на здоровое». Чтобы сгенерировать DI здесь, мы затем повторно классифицировали выборки по случайному лесу, используя новые групповые классификации, и использовали OOB-вероятность «дисбиотической» классификации в качестве показателя индекса.Эти два независимых метода находятся в близком согласии, что оценивается по высокой степени корреляции между показателями дисбиоза CLOUD образцов и их оценкой индекса, основанного на вероятности ( r  = 0,7, p  = 2 × 10 −16 , Корреляции Пирсона). Оценка расстояния CLOUD использовалась во всех последующих анализах. Для сравнения мы также сгруппировали данные с помощью спектральной кластеризации, реализованной в пакете R «kernlab» v0.9.27, с использованием двух центров кластеризации и настроек по умолчанию 41 .

    Предполагаемые функции по составу микробиоты

    Для прогнозирования микробных функций предварительно обработанные считывания ДНК были сопоставлены с базой данных GreenGenes 16 S рРНК версии 13_8 с использованием BURST при 97% идентичности. Полученные таблицы OTU использовались для создания прогнозируемых аннотаций KEGG с использованием PICRUSt v1.1.3 42 . Линейный дискриминантный анализ (LDA) размер эффекта (LEfSe; Galaxy Version 1.0) 43 был затем использован для выявления предполагаемых функций, которые значительно различались (показатель LDA > 2.0) между группами.

    Исследование диетических вмешательств на здоровых добровольцах

    Это было пилотное проспективное одноцентровое диетическое интервенционное исследование на здоровых добровольцах, исходно потреблявших диету с высоким содержанием клетчатки. Исследование было зарегистрировано на сайте Clinicaltrials.gov под номером NCT03266536. Приемлемыми субъектами были здоровые взрослые ( ≥ 18 лет) с исходным потреблением клетчатки  ≥ 11 г/1000 калорий/день; < 10% дневных калорий из добавленного сахара; ≥ 5 порций фруктов и овощей в день; и  ≤ 13% дневных калорий из насыщенных жиров на основе заполненного опросника частоты приема пищи.Пациентов исключали из исследования, если они не соответствовали вышеуказанным диетическим требованиям, имели известный диагноз воспалительного заболевания кишечника, микроскопического колита, глютеновой болезни или других воспалительных состояний, наличие абдоминальных симптомов на основании исходного опросника, прием пероральных антибиотиков или пробиотиков в течение последние 4 недели, беременность или планы забеременеть в течение периода исследования, или любое другое заболевание (я), состояние (я) или привычка (я), которые могут помешать завершению исследования. Инструкции по питанию и выбор продуктов питания обсуждались во время индексного визита лицензированного диетолога до вмешательства.

    Все субъекты были обследованы лично или по телефону и заполнили анкету по частоте приема пищи, чтобы убедиться, что они соответствуют критериям включения и исключения. При первом и последующем посещении им была проведена ФГДС с седацией в сознании. Дуоденальные аспираты были получены с помощью стандартного аспирационного катетера, проведенного через аспирационный порт с минимальным раздуванием в желудке; аликвоту отправляли в клиническую лабораторию для тестирования на SIBO, а оставшуюся часть хранили для анализа микробиома при - 80 °C.Было получено восемь биоптатов двенадцатиперстной кишки для исследований в камере Уссинга, анализа микробиома и секвенирования РНК хозяина. При первоначальном и последующем посещении участники заполнили вопросник по симптомам и демографическим данным и предоставили образец стула. Симптомы, оцениваемые по анкетам, включали: частоту стула, напряжение, неполное опорожнение, твердый/комковатый стул, боль в животе, связанную с дефекацией, диарею/жидкий водянистый стул, вздутие живота, трудности с глотанием, тошноту/рвоту, изжогу, утомляемость и аппетит.Ответы записывались в бинарном порядке (да/нет). Во время вмешательства все участники придерживались 7-дневной стандартизированной диеты с типичным для США распределением калорий по макронутриентам: 50% углеводов, 35% жиров и 15% белков. В рационе было мало клетчатки ( < 10 г/1000 калорий/день) и много простого сахара ( ≥ 50% суточной нормы углеводов).

    Анализ статистической мощности

    Мы выполнили апостериорный расчет мощности для сравнения микробиома между здоровыми и симптомными субъектами, сосредоточив внимание на мощности дифференциального анализа численности, где у нас была гораздо более низкая статистическая мощность по сравнению с анализами альфа- и бета-разнообразия. , из-за многократной коррекции тестирования.Мы использовали онлайн-калькулятор мощности микробиома для проведения анализа мощности (http://fedematt.shinyapps.io/shinyMB/), который был основан на моделировании Монте-Карло и тесте Уилкоксона-Манна-Уитни 44 . Мы использовали коэффициент ложного обнаружения 5%, чтобы скорректировать множественное тестирование. Предполагая, что мы тестируем 65 родов с обилием 10 умеренно обильных родов (ранг обилия 6–15), уменьшающимся на 50% у пациентов с симптомами (по сравнению с 26 дифференциальными родами со средним снижением на 59% в наблюдаемых данных), мы имели средняя мощность 75% для обнаружения этих 10 дифференциальных родов и мощность 100% для обнаружения по крайней мере одного значимого рода при текущем размере выборки.Таким образом, исследование имело достаточные возможности для выявления умеренной разницы в таксонах при сравнении здоровых и симптоматических субъектов.

    Функция эпителиального барьера ex vivo

    Исследования в камере Ussing проводились для измерения барьерной функции слизистой оболочки двенадцатиперстной кишки и секреторных реакций, как описано ранее 45 . Вкратце, биопсии двенадцатиперстной кишки помещали в 4-мл камеры Ussing (Physiologic Instruments, Сан-Диего, Калифорния), обнажая площадь 0,031 см 2  в течение 45 минут после сбора.Камеры заполняли по Кребсу 10 мм маннитом (слизистая сторона) и по Кребсу 10 мм глюкозой (подслизистая сторона). Исходное трансэпителиальное сопротивление и ток короткого замыкания каждой ткани измеряли с использованием пары электродов Ag/AgCl с агарово-солевыми мостиками и пары платиновых электродов, подающих ток, для поддержания условий фиксации напряжения. Парацеллюлярный поток через биоптаты измеряли с использованием 4 кДа FITC-декстрана, вводимого на стороне слизистой оболочки (камерная концентрация 1 мг/мл). Отбор образцов производился со стороны подслизистого слоя каждые 30 минут в течение 3 часов, а кумулятивная флуоресценция измерялась с помощью многорежимного считывателя микропланшетов Synergy Multi-Mode (BioTek, VT) и преобразовывалась в концентрацию с использованием стандартных кривых.Кумулятивный поток в конце 3 ч был рассчитан для ФИТЦ-декстран. Корреляции Спирмена (непараметрические) использовались для проверки связи между разнообразием микробиома и потоком FITC-декстран.

    Последовательность РНК

    Образцы биопсии оттаивали на льду, гомогенизировали и центрифугировали при 13 000 об/мин, а супернатант переносили в новую пробирку. РНК готовили с использованием мини-набора RNeasy (QIAGEN, Hilden, Germany) и секвенировали на Illumina HiSeq 2500. Анализ данных проводили с использованием конвейера Mayo Analysis Pipeline для секвенирования РНК (MAP-RSeq) с выравниванием по сборке генома человека (GRCh48.78) 46 . Вкратце, конвейер MAP-RSeq предварительно формирует оценку качества считываний последовательностей из файла FASTQ, выравнивает оставшиеся оставшиеся считывания с TopHat 47 , а количество генов агрегируется с помощью библиотеки Python HTSeq 48 . Средняя общая глубина чтения составила 57 052 ​​595 (стандартное отклонение 8,5 × 10 6 ) и в среднем 87,0% (стандартное отклонение 2,0%) от общего числа прочтений, сопоставленных с генными моделями. Условная нормализация квантилей была выполнена для учета смещения длины гена и содержания GC 49 .

    1 Подготовка проб H-ЯМР для метаболомики

    Образцы аспирата центрифугировали при 4°C при 12 000 ×  g в течение 5 мин. 162 мкл супернатанта смешивали с 18 мкл буфера ЯМР (1,5 м KH 2 PO 4 , 1 г/л TSP и 0,13 г/л NaN 3 , Sigma-Aldrich) и переносили в 3 мм ЯМР трубка. Образцы фекалий предварительно взвешивали (~ 100 мг), рандомизировали и помещали в пробирку с завинчивающейся крышкой, содержащую 50 мг 1.Циркониевые шарики диаметром 0 мм, к которым было добавлено 400 мкл ACN:H 2 O (1:3). Пробирку помещали в бисерную мешалку Biospec на 30 с. Затем гомогенизированный образец центрифугировали в течение 20 минут при 16 000× г . Супернатант осторожно переносили в пробирки со спин-фильтром и центрифугировали в течение 30 мин при 16000× г . 80 мкл отфильтрованной фекальной воды аликвотировали в 96-луночный планшет, а 10 мкл использовали для контроля качества. Отфильтрованную фекальную воду в 96-луночном планшете сушили в токе азота перед восстановлением с помощью 540 мкл D 2 O (Sigma-Aldrich) и 60 мкл буфера ЯМР.Восстановленную смесь фекальной воды и буфера переносили в экспериментальные пробирки для ЯМР диаметром 5 мм.

    1 Эксперимент Н-ЯМР

    Метаболические профили измеряли на спектрометре Bruker 600 МГц (Bruker Biospin, Райнштеттен, Германия) при постоянной температуре 300 К для образцов мочи, аспирата и кала и 310 К для образцов плазмы. Стандартный одномерный эксперимент NOSY был проведен для каждого образца мочи, аспирата и фекальной воды, а эксперимент CPMG — для образцов плазмы.В общей сложности было получено 64 сканирования на образец в 64 K точек данных для мочи, аспиратов и плазмы; Было собрано 128 сканирований на образец в 64 K точек данных для фекальной воды.

    1 Предварительная обработка данных Н-ЯМР

    Данные спектров были импортированы в MATLAB (версия 8.3.0.532 R2014a, Mathworks Inc, Натик, Массачусетс, США). Для следующих исполнений использовалась серия сценариев собственной разработки. Фазирование, коррекция базовой линии и спектральная калибровка по TSP (0 ppm).Спектры выравнивались вручную. Чтобы учесть разницу в концентрации образцов, к образцам применялась нормализация вероятностного отношения. Собственные сценарии использовались для построения моделей PCA и OPLS-DA и интеграции интересующих пиков. Корреляции признаков и тенденции были проанализированы в R.

    Сводка отчетов

    Дополнительная информация о дизайне исследования доступна в Сводке отчетов об исследованиях Nature, связанной с этой статьей.

    Дисбиоз кишечника, барьерная дисфункция и бактериальная транслокация Объяснение системного воспаления, связанного с ХБП

    Резюме

    ХБП связана с системным воспалением, но основная причина неизвестна.Здесь мы исследовали участие кишечной микробиоты. Мы сообщаем, что у мышей с дефицитом коллагена типа 4 α 3 с прогрессирующей ХБП, связанной с синдромом Альпорта, наблюдается системное воспаление, включая повышенный уровень пентраксина-2 в плазме и активированных антиген-презентирующих клеток, CD4 и CD8 Т-клеток и Th27- или IFNγ. – продукция Т-клеток в селезенке, а также подавление регуляторных Т-клеток. Связанное с ХБП системное воспаление у этих мышей связано с дисбиозом кишечника протеобактериального цветения, транслокацией живых бактерий через кишечный барьер в печень и повышенным уровнем бактериального эндотоксина в сыворотке.Уремия не влияла на высвобождение секреторного IgA в просвет подвздошной кишки или субпопуляции лейкоцитов слизистой оболочки. Чтобы проверить причинно-следственную связь между дисбактериозом и системным воспалением при ХБП, мы ликвидировали факультативную анаэробную микробиоту антибиотиками. Эта эрадикация предотвратила бактериальную транслокацию, значительно снизила уровень эндотоксина в сыворотке и полностью восстановила все маркеры системного воспаления до уровня неуремического контроля. Таким образом, мы делаем вывод, что уремия связана с дисбактериозом кишечника, дисфункцией кишечного барьера и бактериальной транслокацией, которые запускают состояние персистирующего системного воспаления при ХБП.Уремический дисбактериоз и дисфункция кишечного барьера могут быть новыми терапевтическими мишенями для вмешательства, направленного на подавление системного воспаления, связанного с ХБП, и его последствий.

    ХБП связана с персистирующим системным воспалением, вызывающим эндотелиальную дисфункцию, атерогенез и сердечно-сосудистые заболевания, 1 , но основная причина системного воспаления, связанного с ХБП, до сих пор неясна. Считалось, что причиной этого явления являются связанные с диализом инфекции катетеров, загрязненная вода или небиосовместимые трубки и диализные фильтры.Однако уровни циркулирующего бактериального эндотоксина в сыворотке увеличиваются от стадии 2 к стадии 5, 2 , что предполагает наличие эндогенного источника бактериального эндотоксина. Здесь мы сосредоточимся на микробиоте организма как на потенциальном причинном триггере системного воспаления, связанного с ХБП.

    Микробиота представляет собой в 10 раз больше бактериальных клеток, чем клеток человека, находящихся на внешней и внутренней поверхностях тела. 3 Симбионты ограничивают рост патобионтов и дисбиоз. 4 Кишечные симбионты производят необходимые питательные вещества, такие как витамин К и компоненты, которые регулируют многочисленные метаболические процессы в организме. 5 Исследования на стерильных мышах показали, что микробиота формирует и обучает иммунную систему в раннем возрасте. 6 Однако эпителиальные барьеры должны удерживать микробиоту вне организма, чтобы избежать бактериальной транслокации, системного воспаления и смертельных инфекций. 7,8 Хорошо описано, что дисбактериоз, дисфункция кишечного барьера и бактериальная транслокация вызывают и увековечивают воспаление при воспалительных заболеваниях кишечника, 9 портальной гипертензии, 7 или сердечной недостаточности. 10 Таким образом, мы предположили, что метаболические изменения во время уремии аналогичным образом способствуют дисбактериозу кишечника и бактериальной транслокации в качестве триггера для персистирующего состояния системного воспаления, связанного с ХБП.

    Мы выбрали мышей с дефицитом коллагена 4 типа α 3 ( Col4a3 ) для проверки нашей гипотезы, потому что у этих мышей спонтанно развивается прогрессирующий гломерулосклероз и ХБП (нефропатия Альпорта) без каких-либо хирургических, токсических или диетических вмешательств, которые могли бы повлиять на микробиота за пределами метаболических изменений уремии (рис. 1, А и Б). 11 Уремия у 9-недельных мышей Col4a3- с дефицитом ассоциировалась с уровнями в сыворотке пентраксина-2/амилоидного Р-компонента сыворотки, который является функциональным мышиным гомологом С-реактивного белка человека и служит маркером системной воспаление у мышей (рис. 1C). Кроме того, мы проанализировали фенотипирование спленоцитов на 9-й неделе, поскольку селезенка удаляет передающиеся с кровью антигены и инициирует врожденный и адаптивный иммунный ответ против патогенов. Проточная цитометрия показала, что уремия у мышей с дефицитом Col4a3- была связана с увеличением количества активированных CD4 и CD8 T-лимфоцитов (маркер активации CD69) и IL-17- или IFN γ -продуцирующих CD4 T-клеток (рис. 1D).Напротив, количество регуляторных Т-клеток Foxp3+ было снижено по сравнению с контрольными мышами без уремии (рис. 1D). Кроме того, популяция активированных (CD86+) CD11c+ антигенпрезентирующих клеток была увеличена (рис. 1D), что свидетельствует об общем состоянии системной иммунной активации у мышей с дефицитом уремии Col4a3 .

    Рисунок 1.

    Системное воспаление у уремических мышей с дефицитом Col4a3. (A) Гломерулярная и тубулоинтерстициальная патология у 9-недельных мышей Col4a3 с дефицитом иллюстрируется периодическим окрашиванием кислотой-Шиффом.Репрезентативные изображения показаны с исходным увеличением в 400 раз. (B) ХЗП иллюстрируется прогрессирующим снижением СКФ, измеренным чрескожным клиренсом синистрина FITC у мышей в сознании. (C) Уровни пентраксина-2 (PTX2)/амилоида P в сыворотке (SAP) в сыворотке соответствуют человеческому PTX1/C-реактивному белку и указывают на системное воспаление в возрасте 9 недель. (D) Проточный цитометрический анализ лимфоцитов и миелоидных клеток в селезенке 9-недельных неуремических мышей дикого типа и уремических Col4a3 -дефицитных мышей показывает значительное увеличение количества активированных Т-клеток и CD11c+ миелоидных мононуклеарных фагоцитов.Данные представляют собой средние значения ± стандартная ошибка среднего по меньшей мере для пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; ** P <0,01 по сравнению с диким типом; *** P <0,001 по сравнению с диким типом.

    Предполагая, что системное воспаление при уремии связано с изменениями кишечной микробиоты, мы сначала количественно и качественно охарактеризовали кишечную микробиоту у мышей с дефицитом Col4a3 и мышей дикого типа. Хотя мы обнаружили среднее количество факультативных анаэробных бактерий 10 5 –10 6 КОЕ/г фекалий у мышей дикого типа в возрасте 3–9 недель, прогрессирующая ХБП у мышей с дефицитом Col4a3 была связана с увеличением факультативного количество анаэробных бактерий в пять-десять раз по сравнению с мышами дикого типа того же возраста (рис. 2А).Ампликонное секвенирование бактериальных генов 16S рРНК было проведено для характеристики состава фекальной микробиоты у мышей с уремией и без уремии в возрасте 3 и 9 недель. α -Разнообразие, мера сложности микробиоты, было незначительно, но незначительно увеличено у 9-недельных мышей, что соответствует увеличению видового богатства с возрастом. Точно так же не было обнаружено существенной разницы между мышами дикого типа и мышами с дефицитом Col4a3 (дополнительные рисунки 1 и 2). β -Разнообразие, показатель сходства между различными микробными популяциями, определяли путем анализа невзвешенных и взвешенных матриц расстояний UniFrac.Невзвешенные расстояния UniFrac сравнивают микробные сообщества в филогенетическом контексте на основе наличия или отсутствия таксонов (членство в сообществе), тогда как взвешенный UniFrac также включает информацию об относительной численности (структура сообщества). Значительные различия были определены только с помощью невзвешенного UniFrac между мышами дикого типа и мышами с дефицитом Col4a3 в возрасте 9 недель и между мышами дикого типа в возрасте 9 недель и мышами с дефицитом Col4a3 в возрасте 3 недель (дополнительная фигура 3).В частности, в возрасте 9 недель относительная численность Alcaligenaceae β -Proteobacteria (среднее ± стандартная ошибка среднего) составляла от 0,09% ± 0,03% до 0,94% ± 0,42% ( P >0,50), относительная численность Verrucomicrobiaceae (средняя ±SEM) составляла от 0,04%±0,01% до 7,90%±6,95% ( P >0,50), относительная численность Bacteroidetes-Bacteroidaceae (среднее ±SEM) составляла от 1,45%±0,72% до 10,65%±3,72% (P <0,50), а относительная численность Bacteroidetes-Porphyromonadaceae (среднее значение ± стандартная ошибка среднего) составляла 0,92% ± 0.От 25 % до 3,05 % ± 1,05 % ( P > 0,50) у уремических мышей с дефицитом Col4a3, тогда как Bacteroidetes-Bacteroirales снижался у уремических мышей (с 48,05 % ± 7,97 % до 24,57 % ± 10,46 %; P <0,001). (Рисунок 2Б). Дисбактериоз, связанный с уремией, не был связан с какими-либо изменениями подтипов иммунных клеток стенки тонкой кишки или высвобождением секреторного (s) IgA (таблица 1). Следовательно, мы делаем вывод, что прогрессирующая ХБП и сопровождающая ее уремия у мышей с дефицитом Col4a3 связаны с протеобактериальным цветением и дисбиозом.

    Рисунок 2.

    Уремия влияет на разнообразие микробиоты и барьерную функцию кишечника. (A) Количественный дисбактериоз, измеряемый в количестве КОЕ на грамм фекалий, наблюдается у мышей с дефицитом Col4a3 по сравнению с животными дикого типа. С возрастом у Col4a3 -дефицитных мышей развился еще более значительный количественный дисбактериоз. (B) Относительное количество различных таксонов бактерий, обнаруженных в образцах фекалий. Изменения в составе микробиоты кишечника, которые могут быть связаны со старением, обнаруживаются у мышей в возрасте 3 и 9 недель в обеих линиях.Сравнение Col4a3 -дефицитных мышей и мышей дикого типа в возрасте 9 недель демонстрирует различия в порядках Bacteroidales, Burholderiales (семейство Alcaligenaceae), Enterobacteriales и Verrucomicrobiales. Подробная информация, включая статистику, приведена в дополнительной таблице 1. (C) Бактериальные колонии выросли из ткани печени мышей с дефицитом уремии Col4a3 , но не из неуремических мышей дикого типа. (D) Сыворотки мышей с уремией и без уремии были проанализированы с использованием анализа лизата амебоцитов limulus и показали значительно повышенные уровни бактериального эндотоксина.(E) Эксперименты ECIS демонстрируют значительное снижение средней устойчивости в одноклеточных слоях клеток Colon26 после обработки сывороткой мышей с дефицитом уремии Col4a3 (момент времени отмечен стрелками) по сравнению с клетками, обработанными сывороткой мышей дикого типа. . Данные представляют собой средние значения ± стандартная ошибка среднего по меньшей мере для пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; *** P <0,001 по сравнению с диким типом.

    Таблица 1.

    Проточная цитометрия лейкоцитов кишечника у 8,5-недельных мышей Col4a3 -дефицитных иммунная активация отмечена у уремических мышей.Фактически, культуры печени выявили заражение культивируемыми живыми бактериями у 60% всех уремических мышей с дефицитом Col4a3 (рис. 2С), что было связано с тенденцией к более активным макрофагам и дендритным клеткам в печени (таблица 2). Следовательно, мы перорально заражали уремических мышей комменсалом Escherichia coli , конститутивно экспрессирующим зеленый флуоресцентный белок (GFP), через пероральный желудочный зонд. Мы обнаружили GFP+ бактерии в 40% печени мышей с уремией, но не у мышей без уремии (не показано), что свидетельствует о перемещении даже живых бактерий из кишечного тракта.В соответствии с этими выводами, у уремических мышей с дефицитом Col4a3 наблюдались значительно повышенные уровни бактериального эндотоксина в сыворотке по сравнению с мышами дикого типа без уремии (рис. 2D). Тщательный анализ стенки кишечника с помощью периодического окрашивания кислотой-Шиффом, иммуноокрашивания ZO-1 и просвечивающей электронной микроскопии не выявил структурных изменений, таких как язвы или диффузные аномалии плотных контактов, у мышей дикого типа и мышей с дефицитом Col4a3 (дополнительный рисунок). 4). Однако, когда культивированные эпителиальные клетки толстой кишки подвергались воздействию сыворотки уремических мышей с дефицитом Col4a3 или неуремических мышей дикого типа, только уремическая сыворотка снижала трансэпителиальную резистентность как маркер трансэпителиальной проницаемости (рис. 2Е).

    Таблица 2.

    Проточная цитометрия лейкоцитов кишечника у 8,5-недельных мышей Col4a3 -дефицитных с лечением антибиотиками и без него

    — дефицитные мыши с синергической пероральной комбинацией антибиотиков, которая уничтожала факультативную анаэробную кишечную микробиоту из кишечника и печени (рис. 3А). Истощение микробиоты значительно снизило уровни бактериального эндотоксина в сыворотке (рис. 3B) и уровни внутрипеченочной экспрессии мРНК пентраксина-2/сывороточного амилоида P и IL-6 (рис. 3C).Соответственно, проточная цитометрия спленоцитов показала менее активированные Т-клетки и восстановление регуляторных Т-клеток (рис. 3D). Не было обнаружено влияния на функцию почек или внутрипочечные профили лейкоцитов (данные не представлены). Таким образом, мы делаем вывод, что уремический дисбиоз и бактериальная транслокация вызывают системное воспаление, связанное с ХБП.

    Рисунок 3.

    Уремическое системное воспаление корректируется путем эрадикации микробиоты. Все пунктирные линии на B и C представляют значения контрольных животных дикого типа.(A) Репрезентативные фотографии показывают полное уничтожение грамотрицательной фекальной флоры после лечения антибиотиками. График дот-блоттинга иллюстрирует КОЕ культур фекалий в возрасте 7 недель. На графике представлены результаты для неселективных сред, поскольку был взят предел обнаружения (пунктирная линия) 10 КОЕ/г фекалий. (B) Уровни эндотоксина в сыворотке с лечением антибиотиками и без него у мышей с дефицитом Col4a3 . ( C ) Уровни экспрессии мРНК амилоида P и IL-6 в сыворотке крови в острой фазе с лечением антибиотиками и без него у мышей с дефицитом Col4a3 .(D) Проточная цитометрия суспензий клеток селезенки у уремических Col4a3 -дефицитных мышей с лечением антибиотиками и без него. Данные представляют собой средние значения ± стандартная ошибка среднего по меньшей мере для пяти мышей в каждой группе. * P <0,05 по сравнению с диким типом; ** P <0,01 по сравнению с диким типом.

    Бактериальный эндотоксин является важным стимулом для иммунной активации через Toll-подобный рецептор 4 и каспазу 11 при грамотрицательном сепсисе с почечной недостаточностью или без нее. 12,13 Различные стадии ХБП и связанного с ХБП системного воспаления связаны с прогрессивным увеличением циркулирующего бактериального эндотоксина, CD14 и других биомаркеров системного воспаления. 2,14,15 Кроме того, мочевина, секретируемая уремическим организмом в просвет кишечника, способствует образованию уреазообразующих бактерий, которые уже наблюдались у людей и сходны с нашими результатами. 16,17 Некоторые типы уразообразующих бактерий также участвуют в производстве так называемых уремических токсинов, таких как индол или п-крезол, которые, как известно, способствуют системному воспалению. В принципе, причинно-следственная связь этой связи может быть двоякой ( например, , воспаление, связанное с ХБП, может способствовать проникновению эндотоксина, или поступление уремического токсина/эндотоксина, связанного с ХБП, может способствовать воспалению).Наше исследование теперь подтверждает, что системная иммунная активация, связанная с ХБП, обратима при уничтожении микробиоты. Это означает, что именно микробиота отвечает за системное воспаление, связанное с ХБП.

    Системное введение антибиотиков влияет на микробиоту всего тела, и поэтому остается неясным, какая микробиота и из каких областей в наибольшей степени способствует воспалению, связанному с ХБП. Тем не менее, кишечник содержит, безусловно, наибольшее количество бактериальных клеток, и мы также показываем, используя меченый GFP E.coli , транслокация бактерий через кишечный барьер происходит при ХБП. У мышей с уремией даже живые бактерии достигали печени, вероятно, преодолев кишечный эпителиальный барьер и попадая в воротную вену. Как может происходить эта транслокация, не совсем ясно. Сообщалось, что ХБП, вызванная диетой, богатой аденином, у крыс связана с диффузной дезинтеграцией плотных контактов в эпителиальных клетках кишечника. 18-20 Поскольку Col4a3-дефицитные мыши со спонтанной CKD лишены этого феномена, возможно, что такие изменения связаны с индуцированной кристаллами аденина эпителиальной цитотоксичностью, а не с уремией per se .Фактически кристаллы могут оказывать прямое цитотоксическое действие на эпителиальные клетки. 21 Тем не менее, мы и другие обнаружили, что уремическая (но не неуремическая) плазма увеличивает проницаемость монослоев кишечных эпителиальных клеток in vitro . 18 Следовательно, рабочая гипотеза заключается в том, что, по крайней мере, очаговая дисфункция кишечного барьера должна способствовать бактериальной транслокации, и, возможно, дисбиоз кишечника выступает в качестве кофактора.

    Увеличение числа кишечных протеобактерий, связанное с ХБП, представляет собой переход к потенциально патогенным бактериям (патобионтам), что часто связано с широким спектром заболеваний. 22 Наши результаты согласуются с несколькими предыдущими исследованиями на людях с уремией, 16 уремических крысах, 16 и уремических мышах. 23 Кишечный дисбактериоз связан со сдвигом в секреторном профиле микробиоты, включая такие факторы, как метаболит фосфатидилхолина триметиламин N -оксид, который может непосредственно стимулировать прогрессирование ХБП и сердечно-сосудистые заболевания. 24,25 Известно, что микробиота чувствительна к изменениям экосистемы, связанным с диетой или обменом веществ. 26,27 Метаболические изменения при уремии, включая метаболический ацидоз и азотемию, дают многочисленные объяснения сдвигов микробиоты. 26,27 Попытки коррекции уремического дисбактериоза пробиотическими препаратами основаны на идее модулировать уремический дисбактериоз целенаправленными вмешательствами. 28 Вместе мы пришли к выводу, что дисбактериоз кишечника, барьерная дисфункция и бактериальная транслокация являются причиной системного воспаления при ХБП и потенциально полностью обратимы.

    Краткие методы

    Исследования на животных

    Col4a3 – однопометные мыши дикого типа и дефицитные по Col4a3 с идентичным генетическим фоном Sv129 были выведены в определенных свободных от патогенов условиях содержания, помещены в одни и те же клетки и генотипированы, как описано ранее. 29 В возрасте 6 недель группы мышей Col4a3 -дефицитных и мышей дикого типа были рандомизированы для перорального введения 25 мг/кг неомицина, 60 мг/кг ампициллина или 25 мг/кг метронидазола один раз в день. в течение 12 дней.Некоторым мышам E. coli штамм MG1655, несущий плазмиду pM979 для конститутивной экспрессии GFP, вводили перорально на 13-й день. Все исследования на животных были одобрены местным правительственным комитетом по этике.

    СКФ и биоанализы

    СКФ измеряли у мышей, находящихся в сознании, с использованием чрескожной детекторной системы для определения кинетики клиренса FITC синистрина (Mannheim Pharma & Diagnostics GmbH), как описано. 31 Сердечная пункция выполнялась в стерильных условиях, и анализ лизата лимулюсных амебоцитов использовался для количественного определения уровней ЛПС в плазме (HIT302; Hycult Biotech, PB Uden, Нидерланды). Уровни амилоида P в сыворотке определяли с помощью коммерческого набора Mouse Pentraxin 2/SAP Quantikine ELISA Kit (R&D Systems, Миннеаполис, Миннесота).

    Количественная оценка и квалификация бактерий

    Количество КОЕ

    Свежие фекалии растворяли в 500 мкл л PBS, разбавляли и высевали в объеме 50 мкл л на чашки с агаром МакКонки в качестве селективной среды для грамотрицательных бактерий и LB. агаровые пластины как неселективная среда.Планшеты инкубировали в течение 1–2 сут при 37°С в аэробных условиях; 2–3 г органной ткани иссекали в стерильных условиях путем процеживания через стерильное сито с размером ячеек 70- мк мкм, тщательно промывали 500 мк мкл PBS и 100 мк мкл высевали на чашки с агаром Мак-Конки. Для количественного определения ампициллин-резистентной E. coli MG1655 pM979 использовали агар, содержащий ампициллин (100 мк г/мл). Все подсчеты КОЕ рассчитывали на массу введенного образца стула или ткани при пределе обнаружения 10 КОЕ/г для фекалий и 60 КОЕ/г для печени.

    Выделение ДНК стула и секвенирование ампликона гена 16S рРНК

    Набор QIAamp DNA Stool Mini Kit (51504; Qiagen, Germantown, MD) использовали для выделения гДНК из свежесобранных образцов фекалий от обеих линий мышей. Вариабельные области гена 16S рРНК V3–V6 амплифицировали с помощью ПЦР с использованием фекальной гДНК. ПЦР состояла из двух последовательных стадий. Праймеры, направленные на ген 16S рРНК (курсив) и специфических праймеров, несущих адаптеры 5’M13 / RM13 (жирный шрифт) 338F-М13 ( GTAAACGACGGCCAGTG CTCCTACGGGWGGCAGCAGT) и 1044R-RM13 ( GGAAACAGCTATGACCATGA CTACGCGCTGACGACARCCATG) были использованы для амплификации область V3–V6 бактериального гена 16S рРНК.Одна реакция ПЦР содержала по 500 нМ каждого праймера (338F-M13 и 1044R-rM13), 2× DreamTaq PCR Master Mix и 50 нг матричной гДНК. Реакцию ПЦР проводили в двух повторностях с использованием термоциклера peqSTAR 2× Gradient Thermocycler (Peqlab Biotechnology). Условия ПЦР: 95°С в течение 10 минут, затем 20 циклов при 95°С в течение 30 секунд, 55°С в течение 30 секунд и 72°С в течение 45 секунд и конечная стадия элонгации при 72°С в течение 10 минут. Повторные реакции объединяли и загружали в 1% агарозный гель для подтверждения успешной ПЦР-амплификации.После очистки продуктов ПЦР с использованием геля NucleoSpin и набора для очистки ПЦР в соответствии с инструкциями производителя концентрацию и качество очищенных продуктов ПЦР оценивали с помощью Nanodrop (Peqlab Biotechnology). Чтобы штрих-кодировать каждый продукт ПЦР определенной последовательностью MID и добавить 454-специфичную метку Lib-L, вторую ПЦР проводили с использованием M13/rM13-специфичных праймеров, содержащих 454-специфичные праймеры Lib-L (подчеркнуты) A-M13 (CCATCTCATCCCTGCGTGTCTCCGACTCAG). /MIDsequence/ GTAAACGACGGCCAGG ) и B-rM13 ( CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGGAAACAGCTATGA CCATGA ).40 различных штрих-кодов MID размером 10 п.н., исправляющих ошибки, для мультиплексирования перечислены в таблице 3. ПЦР проводили с использованием 400 нМ каждого праймера (A-M13 и B-rM13). Ампликоны второй ПЦР объединяли и очищали осаждением этанолом. Очищенные продукты ПЦР помещали в 0,8% агарозный гель, вырезали полосы, соответствующие последовательностям гена 16S рРНК со штрих-кодом, и экстрагировали ДНК с использованием геля NucleoSpin и набора для очистки ПЦР. ДНК элюировали в ddH 2 O, дополнительно очищали с использованием AMPure Beads (Beckman Coulter, Inc., Brea, CA) и, наконец, ресуспендировали в ddH 2 O. Концентрацию и качество очищенных последовательностей со штрих-кодом оценивали с использованием Nanodrop (Peqlab Biotechnology). Образцы хранили при -20°С. Секвенирование ампликона выполняли в Eurofins на платформе 454 GS FLX Titanium с одной стороны (Lib-L-A) в соответствии с процедурами, рекомендованными для 454 Roche (Roche, Базель, Швейцария).

    Таблица 3.

    Штрих-коды MID для мультиплексирования 454

    Биоинформационный анализ

    Данные были проанализированы, как описано недавно. 32 Вкратце, необработанные последовательности были предварительно обработаны с использованием FASTX-Toolkit и UCHIME. Последовательности, прошедшие фильтрацию качества (минимальное качество 20), были демультиплексированы и обрезаны для удаления коротких ридов (минимальная длина 100). Последовательности проверяли на наличие химер (UCHIME; стандартные параметры) с использованием справочной базы данных microbiomeutils (r20110519). Самостоятельно написанный сценарий создал файл сопоставления и файл fastA, которые использовались в качестве входных данных для Quantitative Insights in Microbial Ecology (QIIME).

    Обработка

    Последовательности анализировали с использованием пакета QIIME. Последовательности были отнесены к рабочим таксономическим единицам с 97% попарной идентичностью, а затем таксономически классифицированы с использованием классификатора RDP. На диаграммах показано относительное обилие таксонов на уровне типов в наборах данных (среднее значение ± стандартная ошибка среднего; n = 5). Репрезентативный набор последовательностей был выровнен с использованием PyNAST. Выравнивание использовалось для построения филогенетического дерева с помощью FastTree. Дерево использовалось для расчета расстояний UniFrac между образцами. 33 PERMANOVA 34 использовался для проверки статистической значимости группировок образцов на основе различных матриц расстояний UniFrac. Для измерений α -разнообразия был выполнен анализ разрежения для расчетного количества видов в каждой пробе с использованием алгоритма наблюдаемых видов в QIIME.

    Оценка ткани

    Части почки, подвздошной кишки и толстой кишки фиксировали в 10% формалине в PBS и заливали в парафин; Срезы 4- мк м окрашивали периодической кислотой–реактивом Шиффа.Для ультраструктурного анализа образцы толстой кишки 8-недельных обработанных и необработанных мышей вырезали и фиксировали в 0,1 М буфере PBS (pH 7,4), дополненном 0,4% параформальдегидом и 2% глутаральдегидом. Полимеризацию (с использованием свежей смолы Epon) проводили при 60°С в течение 24 часов, как описано. 35 В качестве первичных антител для иммунного окрашивания использовали следующие антитела: козьи анти-ZO-1 и кроличьи антиокклюдиновые (ab1

    и ab64482 соответственно; Abcam, Inc., Кембридж, Массачусетс).

    Количественная ОТ-ПЦР в реальном времени

    Тотальную РНК выделяли с использованием набора для выделения РНК (Life Technologies, Карлсбад, Калифорния) в соответствии с инструкциями производителя, а качество РНК оценивали с использованием агарозных гелей.После выделения РНК с помощью обратной транскрипции создавали кДНК (Superscript II; Invitrogen, Carlsbad, CA). Систему обнаружения зеленого красителя SYBR использовали для количественной ПЦР в реальном времени на Light Cycler 480 (Roche) с использованием 18s рРНК в качестве гена домашнего хозяйства. Использовали ген-специфические праймеры, обработанные с помощью ансамбля-BLAST, и праймера NCBI-BLAST (Metabion, Martinsried, Germany), как указано в таблице 4. Нематричные контроли, состоящие из всех использованных реагентов, были отрицательными в отношении генов-мишеней и «домашнего хозяйства». Для снижения риска ложноположительных точек пересечения использовался алгоритм высокой достоверности.Профили кривых плавления анализировали для каждого образца для обнаружения возможных неспецифических продуктов или димеров праймеров. В качестве гена домашнего хозяйства использовали 18s РНК.

    Таблица 4.

    Праймеры, используемые для количественной ОТ-ПЦР в режиме реального времени

    Выделение и проточная цитометрия органных лейкоцитов и стимулированных Т-клеток следующие антитела: анти-CD3

    ε (клон 145-2C11; Becton Dickinson, Сан-Диего, Калифорния), анти-CD4 (клон RM4-5; Becton Dickinson), анти-CD8 (клон 53-6.7; Becton Dickinson), анти-CD69 (клон h2.2F3; Becton Dickinson), анти-FOXP3 (421403; BioLegend, Сан-Диего, Калифорния), анти-CD11c (клон HL3; Becton Dickinson), анти-F4/80 (клон MCA ; AbD Serotec), анти-CD86 (клон GL1; Becton Dickinson) и анти–IL-17 (ebio17B7; Becton Dickinson). Внутриклеточное окрашивание на FoxP3 и IL-17 проводили с использованием набора Cytofix/Cytoperm (Becton Dickinson). Анализ стимуляции Т-клеток проводили на клетках селезенки (прибл. 10 6 ) в 200 мкл мкл буфера PBS; Добавляли 50 нг/мл ацетата форболмиристата и 1 мкг/мл мкг/мл иномицина и инкубировали при 37°C в течение 4.5 часов до окрашивания.

    In Vitro Исследования

    Индуцированные уремической сывороткой изменения сопротивления и емкости бессмертных клеток толстой кишки-26 мышей (лот 400156–812; CLS, Эппельхайм, Германия) анализировали с помощью устройства для измерения импеданса субстрата электрических клеток (ECIS). (Прикладная биофизика Inc., Нью-Йорк, штат Нью-Йорк). Клетки культивировали в среде RPMI Glutamax (Life Sciences, Heidelberg, Germany) с добавлением 10% диализированного FCS (Life Sciences Heidelberg, Германия) перед посевом. Следовательно, 1.0×10 6 замороженных клеток (в 1,0 мл криосреды и 10% ДМСО в диализированной FCS) оттаивали и рекультивировали в указанных средах до слияния. Сначала для измерения ECIS лунки экспериментальной камеры предварительно покрывали на 10 минут цистеином. Во-вторых, еще одно покрытие с 0,01% коллагена (телячья кожа 1 типа) было нанесено на ночь при 4°C. Клетки из того же пассажа высевали с плотностью 600000 клеток на лунку в объеме среды 400 мкл л и инкубировали в течение ночи (37°С и 5% СО 2 ).Среду удаляли на следующий день и осторожно добавляли 360 мкл л свежей среды. Подготовленную камеру подключали к прибору ECIS (многоканальный режим) на 1 час без каких-либо манипуляций. Затем была проведена проверка частоты, а затем еще 1 час в многоканальном режиме. Для стимуляции были взяты скважины без изменений по сопротивлению. Сливающиеся монослои стимулировали 40 мкл мкл сыворотки мышей Sv129 дикого типа (АМК = 24 мг/дл) или мышей с дефицитом Col4a3 (АМК = 240 мг/дл).После стимуляции резистентность регистрировали в течение примерно 18 часов. Начальная точка временной шкалы (рис. 2Е) была установлена ​​на момент времени, когда был достигнут почти постоянный наклон кривых сопротивления.

    Статистический анализ

    Данные представлены как среднее ± стандартная ошибка среднего. Сравнение отдельных групп проводили с использованием тестов t или Манна-Уитни U . Нормальное распределение проверяли с помощью критерия Шапиро-Уилка. Несколько групп были проанализированы с помощью ANOVA с последующим пост-тестом Бонферрони.Считалось, что значение P <0,05 указывает на статистическую значимость. PERMANOVA на невзвешенных и взвешенных матрицах расстояний UniFrac выполнялась в QIIME.

    Благодарности

    Мы благодарим Dan Draganovic, Jana Mandelbaum и Mauel Diekl за квалифицированную техническую помощь.

    Этот проект был поддержан медицинским факультетом Мюнхенского университета. Части этого проекта были подготовлены в качестве докторской диссертации на медицинском факультете Мюнхенского университета М.С.К.

    • Copyright © 2016 Американского общества нефрологов

    Дисбактериоз кишечника | Краткая информация для врача

    Пребиотики — это субстраты, которые избирательно используются микроорганизмами хозяина и могут приносить пользу здоровью хозяина. 19 Они представляют собой неперевариваемые, ферментируемые или неферментируемые волокна, в основном растительного происхождения (например, инулин, некрахмальные полисахариды, дисахариды, олигосахариды, полисахариды). Пребиотики ферментируются кишечной микробиотой до метаболитов (например, короткоцепочечных жирных кислот), 20 , которые поддерживают здоровье с помощью ряда различных механизмов (например, обладают противовоспалительными свойствами, снижают рН кишечника для предотвращения роста патогенных микробов). 21-23 Растворимые пищевые волокна (например, псиллиум, целлюлоза, пектин) обладают водосвязывающими свойствами, улучшающими консистенцию фекалий, увеличивающими толщину слоев кишечной слизи и благотворно влияющими на пролиферацию эпителиальных клеток. Также было показано, что псиллиум обладает свойствами связывания желчных кислот 24 и может оказывать благотворное воздействие на пациентов с секреторной диареей из-за мальабсорбции желчных кислот. Большинство коммерчески доступных диет для ЖКТ содержат большое количество клетчатки, и несколько исследований показали улучшение фекальных показателей после приема клетчатки. 25,26

    Пробиотики представляют собой перорально вводимые живые микроорганизмы, которые при введении в адекватных количествах оказывают благотворное влияние на здоровье хозяина. 27 Пробиотики не вызывают серьезных изменений в резидентной микробиоте, но имеют штаммоспецифические механизмы действия (например, ингибирование патогенной инвазии, 28,29 модулирование иммунной системы хозяина, усиление барьерной функции кишечника). 30 Пробиотик следует выбирать на основе доказанной в научных исследованиях эффективности.Некоторые имеющиеся в продаже пробиотики показали положительный терапевтический эффект при различных желудочно-кишечных заболеваниях у животных. Например, в исследованиях сообщалось о повышенной регуляции кишечных белков плотного соединения в эпителиальном барьере у собак с воспалительным заболеванием кишечника, , 30, , более твердом характере стула у приютских кошек с неосложненной диареей, , 31, , а также о снижении количества энтеротоксигенных Clostridium perfringens в кале и ускоренной нормализации кишечный микробиом у собак с острой геморрагической диареей. 32

    Синбиотики — это продукты, содержащие как пре-, так и пробиотики, которые могут иметь синергетическую пользу для здоровья. 33

    Связь между микробиотой кишечника и патогенезом ревматоидного артрита

    Характеристика и понимание микробиоты кишечника в последнее время расширились, что представляет собой широкую область исследований, особенно в области аутоиммунных заболеваний. Микробиота кишечника является основным источником микробов, которые могут оказывать благотворное, а также патогенное воздействие на здоровье человека.Роль кишечного микробиома как медиатора воспаления стала проявляться совсем недавно. Было обнаружено, что микробиота отличается у субъектов с ранним ревматоидным артритом по сравнению с контрольной группой, и это открытие определило это исследование как возможный аутоиммунный процесс. Исследования кишечной микробиоты показали, что ревматоидный артрит характеризуется увеличением и/или уменьшением групп бактерий по сравнению с контролем. В этом обзоре мы представляем доказательства связи дисбиоза кишечника с аутоиммунными механизмами, участвующими в развитии ревматоидного артрита.

    1. Введение

    Ревматоидный артрит (РА) представляет собой системное, воспалительное и хроническое заболевание, характеризующееся стойким иммунным ответом, которое приводит к воспалению и разрушению суставов. Задействованные этиопатогенные механизмы сложны и включают взаимодействие между врожденным и приобретенным иммунным ответом с участием антигенпрезентирующих клеток (АПК), образование аутореактивных Т-клеток и выработку аутоантител, направленных против их собственных клеточных структур, таких как ревматоидный фактор (РФ) и антитела к антицитруллиновым белкам (АСРА).Эти антитела часто присутствуют в крови задолго до каких-либо признаков воспаления суставов, что позволяет предположить, что запуск аутоиммунитета может происходить в разных местах суставов, например, в желудочно-кишечном тракте или дыхательных путях [1]. Эпидемиологические исследования предполагают, что ревматоидный артрит является результатом сложных взаимодействий между генами, экологическими и гормональными факторами и иммунной системой [2, 3].

    Существует генетическая предрасположенность к ревматоидному артриту по склонности к семейной агрегации, конкордантности между монозиготными близнецами и ассоциации с некоторыми антигенами гистосовместимости [4, 5].Оценки наследуемости предполагают 60–70% генетических факторов риска, ответственных за развитие ревматоидного артрита [6]. Исследования ассоциации генов-кандидатов или полногеномных ассоциаций выявили различные локусы риска, связанные с этиологией ревматоидного артрита. В настоящее время при этом заболевании описано около 100 генов, связанных с восприимчивостью, защитой, тяжестью, активностью и реакцией на лечение [6]. Полиморфизмы человеческого лейкоцитарного антигена (HLA) являются наиболее важными генетическими факторами риска. HLA являются важной частью иммунной системы, запускающей Т-клетки иммунной системы для выработки антител.Ассоциации РА с аллелями HLA-DRB1 наблюдались во всех расовых и этнических популяциях [7, 8]. Общий эпитоп (SE), мотив последовательности из 5 аминокислот в положениях 70–74 цепи HLA-DR β , является наиболее значимым генетическим фактором риска ревматоидного артрита [9]. Некоторые аллели SE, такие как HLA-DRB10401, представляют более высокий риск, чем другие; более того, наличие двух аллелей SE и, в частности, HLA-DRB10401/0404 обуславливает высокий риск развития заболевания, а также влияет на тяжесть заболевания [10].Аллели SE ассоциированы с ACPA-позитивным ревматоидным артритом, но относительно слабо связаны с ACPA-негативным ревматоидным артритом [8]. Аллели SE могут способствовать генетической предрасположенности к ревматоидному артриту, вызывая иммунную дисрегуляцию (контролирующую как специфичность, так и количество выработки ACPA) или преждевременное старение иммунитета [10].

    У генетически предрасположенных к заболеванию лиц последующие триггеры окружающей среды могут вызвать развитие ревматоидного артрита. Бактериальные и вирусные компоненты являются привлекательным источником антигенов, способных индуцировать ревматоидный артрит, и поэтому наиболее изучены в качестве потенциальных причинных агентов [3].Однако на сегодняшний день нет убедительных доказательств причинно-следственной связи микроорганизма с ревматоидным артритом.

    В последние годы характеризация и понимание этой кишечной микробиоты расширились и представляют собой широкое поле для исследований, особенно при аутоиммунных заболеваниях. Микробиота кишечника является основным источником микробов, которые могут оказывать благотворное, а также патогенное воздействие на здоровье человека [11]. Воодушевленный исследованиями, показывающими изменения состава кишечной микробиоты при аутоиммунных заболеваниях, таких как ревматоидный артрит, возобновился интерес к изучению микроорганизмов как потенциальных кандидатов в развитии аутоиммунитета [11–14].

    Результаты, подтверждающие идею о том, что начало аутоиммунитета может быть связано с желудочно-кишечным трактом, следующие: (1) микробный состав у субъектов с ранним ревматоидным артритом отличается от контрольной группы с уменьшением количества определенных бактерий, принадлежащих к семейству Bifidobacterium и Bacteroides [15, 16] и заметное увеличение видов, принадлежащих к роду Prevotella [17]. (2) В мышиных моделях парентеральная инъекция фрагментов клеточных стенок различных кишечных бактерий вызывает артрит [17], и в этой модели артрит не развивается при разведении в безмикробных условиях; в противном случае он проявляется при введении видов кишечных бактерий [18].(3) Было показано, что диета влияет на уровень воспалительной активности [19]. (4) Некоторые препараты, используемые для лечения ревматоидного артрита, обладают антимикробным действием (хлорохин, сульфасалазин, миноциклин и рокситромицин) [20–23]. (5) Измененный микробиом частично восстанавливался до нормы у пациентов с клиническим улучшением после назначения базисных противоревматических препаратов [5, 18]. Таким образом, различия в составе кишечной микробиоты и в функции иммунной системы могут определять, у каких пациентов развивается заболевание.

    В настоящее время предпринимаются большие усилия для изучения пациентов с ревматоидным артритом в доклинической фазе. Осведомленность о механизмах, которые инициируют аутоиммунный процесс, а также о механизмах, участвующих в переходе от доклинической фазы к клинической, может привести к стратегиям вмешательства, которые позволят предотвратить или лечить его на очень ранних стадиях заболевания. В некоторых публикациях предполагается, что раннее лечение ревматоидного артрита приводит к лучшим отдаленным результатам и, возможно, к увеличению частоты безмедикаментозной ремиссии [24].Концепция профилактики — это новая область исследований в области ревматологии, в которой изменения микробиоты могут стать новым способом модулирования заболевания.

    2. Иммунопатогенез ревматоидного артрита

    Понимание сложных молекулярных процессов, играющих роль в патогенезе ревматоидного артрита, все еще остается сложной задачей. У предрасположенных к генетическим и экологическим факторам лиц с потерей иммунологической толерантности к аутоантигенам возникают аутоиммунные явления и образование аутоантител [25].Это отсутствие иммунологической толерантности представляет собой первый шаг к аутоиммунитету. Дисрегуляция иммунной системы характеризуется наличием аутоантител и аутореактивных Т-клеток. Неадекватное образование аутореактивных В-клеток является наиболее очевидным изменением иммунной системы у этих пациентов; их выявляют задолго до появления болезни. Наиболее важными являются RF и ACPA, которые распознают различные белки в цитруллиновой форме [26]. Наряду с повышенной продукцией аутоантител в синовиальной оболочке суставов больных ревматоидным артритом повышен уровень провоспалительных цитокинов.Суставы больных РА представляют собой сложные ткани, в которые вовлечены врожденные и адаптивные иммунные клетки, а также резидентные клетки суставов, такие как синовиоциты и хондроциты [27].

    Было идентифицировано несколько типов клеток, которые вносят вклад в патогенный контекст при ревматоидном артрите. В ревматоидной синовиальной оболочке дендритные клетки обнаруживаются главным образом в лимфоцитарных скоплениях и периферических сосудах, что предполагает их происхождение из периферической крови. Аллели MHC экспрессируются APC, которые процессируют внеклеточные пептиды до CD4 + Т-клеток, стимулируя секрецию провоспалительных цитокинов, которые стимулируют В-клетки к продукции антител [25].У пациентов с этим заболеванием наблюдается нарушение функции циркулирующих регуляторных Т-клеток (Treg) и увеличение числа Т-хелперов 17 (Th27) в плазме и синовиальной жидкости [28]. Трансформирующий фактор роста β , происходящий из макрофагов и дендритных клеток, и интерлейкин-1 β , 6, 21 и 23 обеспечивают среду, которая поддерживает дифференцировку Th27 и подавляет дифференцировку регуляторных Т-клеток, тем самым сдвигая гомеостаз Т-клеток в сторону воспаления [29].

    Посттрансляционные модификации (ПТМ) имеют решающее значение для функции и антигенности белков.Три ПТМ, в первую очередь вовлеченные в ревматоидный артрит, представляют собой гликозилирование, карбамилирование и цитруллинирование [25]. Цитруллинирование является результатом превращения аргинина в цитруллин с помощью фермента пептидиларгининдезиминазы (PAD), и это является основной важной посттранскрипционной модификацией, связанной с распознаванием аутоантигена при ревматоидном артрите [25]. Цитруллин может изменять структуру белка и генерировать новые эпитопы, связанные с продукцией ACPA. ACPA, присутствующие у пациентов с ревматоидным артритом, демонстрируют различную тонкую специфичность и степень перекрестной реактивности с различными цитруллинированными и/или посттрансляционно модифицированными пептидами/белками, включая фибриноген, фибронектин, α -энолазу, коллаген II типа и гистоны [30].

    В таблице 1 обобщены соответствующие аспекты эволюции этого заболевания. Доклинический ревматоидный артрит включает период, в течение которого аутоиммунитет выявляется до начала воспаления и/или повреждения клинически выраженной ткани, генетические факторы риска и факторы риска окружающей среды взаимодействуют, вероятно, последовательно, чтобы инициировать и распространять развитие аутоиммунитета, что в конечном итоге приводит к выявляемым воспаление и поражение тканей [24, 31]. Причастен ли какой-либо другой фактор риска к возникновению и/или распространению заболевания, пока неизвестно.

    +
    +

    91 371
    Фаза начала заболевания (взаимодействие между генно-гормонально-факторов окружающей среды) 91 371 Доклинические РА 91 371 Клиническая РА 91 371 91 372 91 365
    91 371 91 372 91 365
    генетических и эпигенетических факторов Гормональные факторы Экологические факторы Иммунологические изменения Иммунологические изменения
    эпитоп, PTPN22, STAT4, CTLA4, TRAF1, PADI4, FCRL3, TNFIP3
    метилирование ДНК
    дисрегулируемые гистона помечает
    Отношения человека : женщина 4 : 1
    Артрит улучшается во время беременности, но рецидивирует после родов
    Микробиота полости рта, легких и кишечника
    Курение
    Кремниевая пыль
    Ожирение
    Диета
    Неадекватная реакция на пептиды
    Клетки T14 и рост аутореактивных клеток B14 Расширение изотипа антител использование и переключение классов
    Изменения в сетях растворимых цитокинов и хемокинов
    Измененные клетки Th27 и соотношения Th27/регуляторные Т-клетки
    Активация сигнальных молекул
    Иммуноопосредованное воспаление тканей
    Изменения аутоантител, такие как гликозилирование
    Клеточная экспансия
    2 6
    2 Клинические проявления
    Клинические проявления
    Наличие аутоантител (РФ, ACPAs)
    неспецифические симптомы
    артрит
    Bone эрозий
    Системные симптомы
    Формы вмешательства
    Подвеска курения
    Избегайте контакта с диоксидом кремния
    Здоровое питание
    Поддержание адекватного веса
    Модификации микробиоты?
    В исследованиях раннее использование ритуксимаба или абатацепта
    Модификации микробиоты?
    Противовоспалительные
    Биологические и небиологические препараты, модифицирующие течение болезни
    Глюкокортикоиды

    ACPA могут иметь важное значение при переходе от клинической фазы артрита к доклинической.Анализ репертуара ACPA до постановки диагноза у пациентов с ревматоидным артритом показал, что этот иммунный ответ начинается очень ограниченным образом и распространяется до нескольких месяцев или даже лет (распространение эпитопа, от одного первоначально распознанного эпитопа к реактивности ко многим различным эпитопам) до постановки диагноза. ревматоидного артрита [10, 24, 32, 33]. Распространение эпитопов в сторону более цитруллинированных совместимо с возможностью того, что один антиген (но не всегда один и тот же) отвечает за запуск иммунного ответа [16, 32].Соколов и др. [33] сообщили, что ранее идентифицированные аутоантитела были направлены против различных лигандов врожденного иммунного ответа, включая цитруллинированные гистоны, фибриноген и бигликан. Со временем титры ACPA и разнообразие эпитопов ACPA увеличиваются, особенно перед началом артрита. ACPA могут быть изотипами IgG, IgA или IgM с измененным статусом гликозилирования, что обеспечивает усиленное связывание Fc-рецептора и цитруллинированного антигена [34]. ACPA сами по себе могут быть патогенными, активируя либо макрофаги, либо остеокласты посредством образования иммунных комплексов и взаимодействия с Fc-рецепторами или, возможно, связывая мембранный цитруллинированный виментин, тем самым способствуя потере костной массы [34].

    С момента первоначального описания антител как цитруллинированных антигенов у субпопуляции больных ревматоидным артритом стало ясно, что цитруллинированные эпитопы большого числа аутоантигенов, а также антигенов, полученных из микроорганизмов, могут быть распознаны высокоспецифичными антителами к ревматоидному артриту. 30]. Изменения в определенных участках слизистой оболочки предполагают, что микробные факторы могут влиять на иммунный ответ слизистой оболочки, что также играет важную роль в раннем патогенезе ревматоидного артрита [35].Изменения в разнообразии состава и уровне численности микробиоты, то есть дисбактериоз, могут вызывать несколько типов аутоиммунных и воспалительных заболеваний из-за дисбаланса субпопуляций Т-клеток, таких как клетки Th2, Th3, Th27 и Treg [27].

    Дисбактериоз в одном или нескольких участках слизистой оболочки приводит к иммунным изменениям и нарушению толерантности к цитруллинированным аутоантигенам [35]. Слизистые поверхности тела, такие как дыхательный и желудочно-кишечный тракт, выполняют сложные задачи, поскольку они должны (1) оставаться устойчивыми к безвредным антигенам окружающей среды, пищи и микробов для обеспечения функции органов и (2) устанавливать эффективные иммунные ответы против вторгающихся патогенов [36].Ткани легких и кишечника содержат иммунологические клетки, способные инициировать иммунный ответ; привлекательной возможностью является то, что запуск опосредованного Т-клетками иммунитета к цитруллинированным аутоантигенам может происходить в слизистых оболочках после презентации неоантигенов АПК [1, 31]. В слизистой оболочке могут существовать возможные роли цитруллинированных микробных антигенов и молекулярной мимикрии, сигналов Toll-подобных рецепторов (TLR) и других врожденных иммунных активаторов и сигналов опасности [35]. Ассоциированная со слизистой оболочкой бактериальная флора и частицы курения или окружающей среды (кремнеземная пыль) воздействуют на иммунные клетки (нейтрофилы, дендритные клетки и макрофаги) как патоген-ассоциированные молекулярные паттерны и повреждают их, что приводит к возникновению воспаления, увеличению циркулирующих цитокинов и хемокинов наряду с продукция аутоантигенов.Цитруллинированные антигены процессируются и представляются АПК Т-клеткам, которые активируются и, в свою очередь, активируют В-клетки, что приводит к продукции аутоантител [31]. Аутоантигены при ревматоидном артрите не являются ткане- и органоспецифичными, а включают большой набор посттрансляционно модифицированных белков [31]. Курение и другие раздражители могут инициировать цитруллинирование за счет активации PAD, образования лимфоидных структур, которые могут усиливать презентацию антигена и продукцию Т- и В-клеток [31].Потенциальные механизмы, с помощью которых сигаретный дым (CS) способствует ревматоидному артриту, включают высвобождение внутриклеточных белков из реактивных окислительных веществ, активированных или поврежденных клеток, усиление функции аутореактивных В-клеток и изменение (а) многих клеточных сигнальных путей, участвующих в клеточной активации, (b ) антигенпрезентирующие клетки, поврежденные сигаретным дымом, (c) регуляторные функции Т-клеток и (d) активация Т-клеток антигенами, обнаруженными в сигаретном дыме [37].

    3. Микробиота и иммунная система

    Микробное воздействие на желудочно-кишечный тракт и дыхательные пути являются ключевыми детерминантами общего иммунного тонуса этих слизистых барьеров и представляют собой ведущую цель будущих стратегий вмешательства [36].Кишечник является входом для различных антигенов окружающей среды в виде пищи или инфекционных агентов. Кишечная микробиота является фактором, влияющим на метаболический гомеостаз и иммунную систему [5]; это место замечательного взаимодействия между микроорганизмами и человеческим телом. Микроорганизмы устанавливают симбиотические отношения с эпителиальной и лимфоидной тканью [12, 25]. Кишечные бактерии синтезируют и изменяют различные соединения, влияющие на физиологию и иммунитет. Однако не все взаимодействия между хозяином и микробиотой способствуют здоровью, особенно виды резидентных бактерий, по-видимому, активируют иммунную систему, что приводит к воспалительным заболеваниям [38, 39].Разнообразная и сбалансированная микробиота необходима для развития соответствующего иммунного ответа [40].

    Преимущества кишечной микробиоты для хозяина зависят от сложных взаимодействий с клетками хозяина [41]. Исследования с использованием безмикробных и гнотобиотических животных, колонизированных определенными бактериями, предоставили прямые доказательства решающей роли микробиоты в развитии и поддержании иммунной системы хозяина [41] и сохранении ее функций, таких как созревание кишечной лимфоидной ткани, секреция иммуноглобулина А. и производство важных антимикробных пептидов [42].У аксеничных мышей наблюдали скудный рост лимфоидной ткани и изменения в развитии Т-клеток и субпопуляций В-лимфоцитов; в некоторых случаях у этих мышей не развивались заболевания, характерные для обычных субъектов, вероятно, из-за дефектов адаптивной иммунной системы в отсутствие микробиоты, а не из-за отсутствия микроорганизмов как таковых. Консервативные молекулярные паттерны, либо экспрессируемые на поверхности симбиотических бактерий, либо секретируемые в кишечнике, могут взаимодействовать с рецепторами распознавания паттернов (PRR), которые экспрессируются на эпителиальных и лимфоидных клетках или внутри них, чтобы инициировать трансдукцию и транскрипцию сигналов от набора молекул. которые опосредуют защиту хозяина или метаболическую активность в кишечнике [40].

    Было показано, что кишечная комменсальная микробиота модулирует ответы Т-клеток и Treg, которые необходимы для эффективной защиты хозяина от патогенов, обходя аутоиммунные реакции и другие иммунопатологические последствия [43]. В качестве первой линии защиты хозяина от патогенов врожденный иммунный ответ опирается на семейство рецепторов, известных как PRR, включая TLR и рецепторы, подобные домену олигомеризации, связывающему нуклеотиды (NLR). TLR являются ключевыми рецепторами врожденного иммунитета для восприятия патоген-ассоциированных молекулярных паттернов (PAMP), которые представляют собой специфическую патогенную «молекулярную сигнатуру».«После обнаружения микробных PAMP TLR позволяют инициировать воспалительные реакции и в конечном итоге устранить патогенных захватчиков [43]. Компоненты грамположительных и грамотрицательных бактерий взаимодействуют с TLR, опосредуя как врожденный, так и адаптивный иммунитет, а также другие клеточные функции слизистого барьера [40]. Эпителиальные клетки имеют TLR на своей клеточной мембране, которые позволяют распознавать PAMP и активировать передачу сигналов, опосредованную связывающим белком MyD88, которая заканчивается индукцией воспалительной реакции и выработкой провоспалительных цитокинов, таких как фактор некроза опухоли-альфа (TNF- α ), интерлейкин-6 или интерлейкин-1 β .Клетки врожденного иммунного ответа собственной пластинки постоянно исследуют содержимое просвета кишечника на наличие чужеродных антигенов и составляют еще один защитный механизм [28]. Поскольку комменсальные бактерии различаются по своей способности стимулировать рецепторы врожденного иммунитета (TLR и NLR), структура высвобождаемых химических медиаторов значительно различается, определяя провоспалительные или противовоспалительные реакции. Липополисахарид грамотрицательных бактерий связывается с TLR-4, тогда как пептидогликан и другие компоненты клеточной стенки грамположительных бактерий сигнализируют через путь TLR-2, генерируя иммунный ответ [11].Грамположительные анаэробные бактерии содержат большее количество полисахаридов и пептидогликанов, которые могут действовать как антигенные стимуляторы.

    После взаимодействия с антигеном дендритные клетки играют важную роль в дифференцировке незрелых лимфоцитов CD4 + в клетки Th2, Th27 или Th3. Дифференцировка Т-хелперов, по-видимому, находится под сильным влиянием кишечной микробиоты [11, 16, 42]. Дендритные клетки действуют как APC, отображая заряженные пептиды в своих молекулах MHC класса II.Презентация этих молекул В-клеткам или рецепторам Т-клеток делает эти клетки чувствительными к инициации адаптивного иммунного ответа [28]. При ревматоидном артрите дендритные клетки могут участвовать в поддержании воспалительного процесса, регулируя презентацию антигена, и тогда презентация антигена или артритогенных антигенов будет аномально продолжительной, что может способствовать сохранению воспаления. Макрофаги и дендритные клетки постоянно обнаруживают антигены в просвете кишечника и оценивают наличие вредных антигенов.Антигены представлены молекулами MHC II и взаимодействуют с В-клетками или рецепторами Т-клеток, вызывая адаптивные иммунные ответы. В зависимости от микробного антигена затем создается специфическая цитозиновая среда, которая влияет на определенный тип дифференцировки Т-хелперов. В то время как Т-хелперные клетки 1-го типа (Th2) развиваются в ответ на внутриклеточные патогены и продуцируют интерферон, как Т-хелперные клетки 2-го типа (Th3), так и Th27-клетки стимулируются внеклеточными микроорганизмами. Клетки Th27 способствуют защите от внеклеточных патогенов за счет продукции IL-17 и IL-22, которые индуцируют изменение класса иммуноглобулинов в В-лимфоцитах и ​​продукцию Reg3g эпителиальными клетками соответственно [14].Иммунный ответ, генерируемый эффекторными Т-клетками, регулируется субпопуляцией, известной как регуляторные Treg-клетки. Кишечные Treg-клетки играют важную роль в поддержании иммунной толерантности к пищевым антигенам и микробиоте кишечника [44]. Клетки Treg сохраняют толерантность к собственным антигенам и устраняют аутоиммунитет. CD4 + CD25 + Treg-клетки являются супрессорными клетками, которые экспрессируют фактор транскрипции Foxp3 и незаменимы для поддержания иммунной толерантности и гомеостаза путем подавления аберрантного или чрезмерного иммунного ответа. Lactobacillus и Bifidobacterium infantis оказывают противовоспалительное действие за счет индукции Treg-клеток CD4 + CD25 + FoxP3 + [11]. Полисахарид А Bacteroides fragilis действует как иммуномодулятор и стимулирует клетки CD4 + Treg через интерлейкин-2-зависимый механизм для продукции IL-10 [11].

    Принимая во внимание тот факт, что дендритные клетки играют основную роль в формировании иммунного ответа, было высказано предположение, что комменсальные бактерии влияют на функцию и дифференцировку дендритных клеток, тем самым модулируя иммунный ответ [11, 23].Таким образом, дисбактериоз кишечника может вызывать артрит, влияя на дифференцировку подгрупп Т-клеток. Он также влияет на степень экспрессии Toll-подобных рецепторов антигенпрезентирующих клеток и может способствовать дисбалансу в соотношении клеток Th27/Treg. При развитии клеток Th27, активирующих локальные воспалительные каскады с повреждением тканей, и у предрасположенных лиц этот локальный иммунный ответ может привести к системному аутоиммунитету с аутореактивными клетками Th27.

    Наиболее заметное влияние окружающей среды на дифференцировку клеток Th27 оказывает микробиота.В последнее время большое внимание уделяется сегментоядерным нитчатым бактериям (SFB) из-за их способности индуцировать продукцию и активацию клеток Th27 в кишечнике с секрецией интерлейкина-17 [23, 27]. SFB составляют группу родственных клостридиям грамположительных бактерий, которые плотно прилегают к пейеровым бляшкам в тонком кишечнике и могут стимулировать иммунный ответ, индуцируя секрецию IgA и активируя В-клетки. Эти бактерии необходимы для развития аутоиммунитета в мышиной модели артрита K/BxN [45], а применение антибиотиков предотвращает прогрессирование артрита [13, 30, 31].Исследования на мышиных моделях показали, что индукция клеток T FH и Th27 предшествует возникновению артрита, что указывает на роль обоих типов клеток. Моноколонизация с помощью SFB усиливает выработку аутоантител и ускоряет прогрессирование заболевания за счет образования клеток Th27, хотя процесс, зависящий от клеток T FH , индуцированный микробиотой, также может спровоцировать заболевание [44]. Тенг и др. [46] продемонстрировали, что SFB запускает аутоиммунный артрит, индуцируя дифференцировку и миграцию кишечных Т-фолликулярных хелперных клеток (T FH ) в системные лимфоидные участки, что приводит к увеличению продукции аутоантител и обострению артрита.Напротив, Block et al. [45, 47] подтвердили роль кишечной микробиоты в дифференцировке клеток T FH и формировании зародышевого центра. Истощение кишечной микробиоты у мышей антибиотиками снижало количество клеток T FH и уровни продукции антител. Они пришли к выводу, что кишечная микробиота регулирует развитие артрита посредством T FH независимо от клеток Th27.

    4. Дисбиоз при ревматоидном артрите

    Важность кишечного микробиома в аутоиммунитете, связанном с ревматоидным артритом, была выявлена ​​как в моделях на мышах, так и в исследованиях на людях.Изменения микробиоты связаны с риском и тяжестью заболевания. Три места были особенно связаны с ним, в основном легкие, слизистая оболочка полости рта и желудочно-кишечный тракт. Тем не менее, место(а) запуска начального иммунного ответа еще предстоит проверить. В то время как точные механизмы, которые повышают риск, не полностью понятны для каждого из них, вполне вероятно, что локальный тканевой стресс приводит к посттрансляционной модификации пептидов с последующим образованием антител, выступающих в качестве общего механизма [48].

    Аномалии дыхательных путей и цитруллинирование легочной ткани обнаруживаются как у пациентов с ревматоидным артритом, так и у лиц из групп риска. Это предполагает, что легкие являются возможным местом генерации аутоиммунитета [49]. Доказательства ранней роли адаптивного иммунитета и иммунной активации в легких этих пациентов получены в протеомном исследовании, в котором два общих цитруллинированных пептида виментина были описаны в бронхиальной ткани у пациентов с ранним ревматоидным артритом и синовиальной ткани у пациентов с уже установленным заболеванием. некоторые сведения об иммунном процессе, инициированном в легких [25].Слизистая оболочка легких как аутоиммунное происхождение процесса основывается на следующих наблюдениях: АСРА представлены в мокроте ACPA-позитивных больных без артрита; отмечаются микроскопические и макроскопические изменения в легких при раннем ревматоидном артрите и у нелеченных ACPA-положительных больных; легочные изменения были продемонстрированы при компьютерной томографии с высоким разрешением у субъектов без заболевания, но с ACPA-положительным; образцы легочной биопсии от пациентов с ACPA-положительным диагнозом с установленным АР позволяют предположить, что ACPA вырабатываются локально.Однако точные молекулярные механизмы, которые могут быть ответственны за запуск иммунитета в слизистой оболочке легких, относительно не изучены. Известно, что воздействие на легкие вредных агентов, в том числе дыма, может вызывать усиление экспрессии и активацию ЗПА [1]. Было высказано предположение, что цитруллинированные белки могут стать аутоантигенами и тем самым вызвать реакцию иммунной системы у людей с генетической предрасположенностью к ревматоидному артриту.

    Курение и пародонтит способствуют цитруллинированию белка и продукции ACPA [50].Внимание в деснах обусловлено заболеванием пародонта, чаще встречается у лиц с ревматоидным артритом или коррелирует с его активностью. Было высказано предположение, что пародонтальные патогены вызывают системное воспаление или диссеминируют в пораженные ткани. Действительно, при РА сообщалось об увеличении специфического IgG к пародонтальным патогенам, включая Prevotella intermedia и Porphyromonas gingivalis [51]. Присутствие P. intermedia и P. gingivalis в поддесневом зубном налете, а также в синовиальной жидкости подтверждает роль микробиоты в инициировании или поддержании хронического воспаления [52].Поперечные исследования выявили корреляцию между РА и более высокими титрами сывороточных антител против предполагаемых пародонтальных патогенов, таких как P. gingivalis , Prevotella melaninogenica и Tannerella forsythia [53]. Пероральная инокуляция P. gingivalis и Prevotella nigrescens усугубляла тяжесть артрита в экспериментальной мышиной модели, направляя иммунный путь на выработку IL-17 и генерацию ответа Th27 [54].Эффекты двух бактерий отличались тем, что P. nigrescens , в отличие от P. gingivalis , подавляли защитные цитокины 2-го типа, включая IL-4. P. gingivalis экспрессирует фермент с аминодезиминазной активностью, который превращает С-концевой аргинин в цитруллин, аналогичный ферменту, участвующему в этиологии ревматоидного артрита. Цитруллинирование бактериальных и человеческих белков с помощью PAD может обнажать скрытые эпитопы, что приводит к потере толерантности у генетически восприимчивых людей.Считается, что результирующий иммунный ответ вместе с эндогенным цитруллинированием продуцирует ACPA [4]. Тот факт, что курение тесно связано с наличием пародонтита и инфекции P. gingivalis , дает косвенные доказательства в пользу этой гипотезы. Однако последние эпидемиологические данные не продемонстрировали четкой связи между пародонтитом и ревматоидным артритом [1].

    Недавно микробиота кишечника была предложена в качестве незаменимого фактора окружающей среды в прогрессировании ревматоидного артрита [5, 18, 27, 55–57].Беннике и др. [43] идентифицировали 21 цитруллинированный пептид в ткани толстой кишки как у пациентов с ревматоидным артритом, так и у контрольной группы, которые ранее были обнаружены в легочной ткани и синовиальной жидкости у пациентов с РА. Три цитруллинированных белка (цитруллинированный виментин, фибриноген-альфа и актин) являются известными мишенями для ACPA, подтверждая, что слизистая оболочка толстой кишки может быть потенциальным местом нарушения иммунной толерантности к цитруллинированным эпитопам. Цитруллиновый виментин был обнаружен с повышенным содержанием в ткани толстой кишки этих пациентов по сравнению с контрольной группой, что может указывать на то, что начальный запуск ревматоидного артрита не ограничивается только определенным местом в организме, но может происходить во многих других местах [43].Таким образом, это исследование подтверждает гипотезу о том, что слизистая оболочка толстой кишки может служить местом нарушения иммунной толерантности к цитруллиновым белкам, вызывая выработку ACPA у пациентов с ослабленной иммунной системой.

    5. Микробиота кишечника при ревматоидном артрите

    Потенциальная роль микробиоты кишечника в этиопатогенезе ревматоидного артрита подтверждается исследованиями на животных моделях, исследованиями микробиомы кишечника и косвенно влиянием диеты и пробиотиков на степень воспаления Мероприятия.Патофизиологические механизмы, с помощью которых микробиота кишечника связана с артритом, вероятно, многофакторны; предполагаемые механизмы включают активацию антигенпрезентирующих клеток за счет воздействия на TLR или NLR, способность вызывать цитруллинизацию пептидов за счет ферментативного действия, антигенную мимикрию, изменения проницаемости слизистой оболочки кишечника, контроль иммунной системы хозяина (запуск дифференцировки Т-клеток) и увеличение опосредованного Т-хелперами типа 17 воспаления слизистой оболочки.

    Несмотря на существование моделей на животных, хорошо известно, что не существует модели на животных, которая полностью представляет ревматоидный артрит [58].Однако мышиные модели артрита индуцируют эрозивный полиартрит путем внутрибрюшинной инъекции фрагментов клеточной стенки Streptococcus pyogenes , Lactobacillus casei и Eubacterium aerofaciens [59–61]. Артритогенность бактериальных структур зависит от вида бактерий, и, что примечательно, даже бактерии из нормальной микробиоты кишечника вызывают экспериментальный артрит у животных [17]. У гнотобиотических мышей артрит не развивается, и введения SFB достаточно для реинтеграции клеток Th27 из собственной пластинки, большей продукции аутоантител и быстрого развития деструктивного артрита [62].Лечение антибиотиками предотвращает и подавляет фенотип, сходный с ревматоидным артритом, в нескольких мышиных моделях [4, 18, 28], а у генетически предрасположенных мышей дисбиоз повышает чувствительность к артриту за счет активации аутореактивных Т-клеток в кишечнике [63].

    Роль кишечной микробиоты в патогенезе артрита была продемонстрирована индукцией/обострением артрита на экспериментальных мышиных моделях [55, 64–66]. Исследования на мышах-гнотобиотиках показали, что нарушения кишечной микробиоты могут вызывать выработку провоспалительных цитокинов, интерлейкина-17 и повышение уровня клеток Th27 даже во внекишечных тканях [11].Затем клетки Th27 мигрируют в периферическую лимфоидную ткань и секретируют IL-17, который, в свою очередь, действует непосредственно на В-клетки и индуцирует системную дифференцировку В-клеток и выработку антител [67]. В конечном итоге это может привести к развитию аутоиммунного заболевания за счет распознавания молекулярных паттернов кишечной микробиоты [67]. У мышей с нокаутом антагониста рецептора IL-1 (IL-1Ra), у которых спонтанно развивается аутоиммунный артрит, опосредованный Т-клетками, заболевание не развивается при выращивании в безмикробной среде. Однако колонизация пригородной Lactobacillus bifidus вызывает быстрое начало заболевания, тяжесть и заболеваемость, сравнимые с артритом, наблюдаемым у мышей. L. bifidus вызывает артрит в этой модели, способствуя дисбалансу гомеостаза клеток Treg-Th27 и опосредованно через передачу сигналов Toll-подобных рецепторов (TLR2-TLR4) [28, 65]. Лю и др. [64] обнаружили, что род Lactobacillus был значительно более распространен у мышей, восприимчивых к коллаген-индуцированному артриту (CIA-), до начала артрита, чем у мышей, устойчивых к CIA. Примечательно, что у безмикробных мышей с микробиотой от мышей, восприимчивых к CIA, наблюдалась более высокая частота индукции артрита, чем у обычных мышей с микробиотой от мышей, устойчивых к CIA.Моноколонизации безмикробных мышей K/BxN с SFB было достаточно, чтобы стимулировать выработку аутоантител и патогенных клеток Th27, а также вызвать артрит [66]. Системные дефициты стерильных животных отражают потерю клеток Th27 из собственной пластинки кишечника. Введение одного вида резидентных кишечных нитчатых бактерий восстанавливало компартмент клеток Th27 в собственной пластинке; продукция аутоантител и артрит возникали быстро. Таким образом, один комменсальный микроб благодаря своей способности стимулировать специфическую субпопуляцию Т-хелперных клеток может привести к аутоиммунному заболеванию [66].Эти результаты свидетельствуют о том, что комменсальные бактерии могут вызывать аутоиммунный артрит, индуцируя Th27-ответ в кишечнике. Следовательно, состав микробиоты кишечника играет ключевую роль в балансе между воспалительными Th-клетками и супрессорными Treg-клетками для поддержания иммунной толерантности в здоровых условиях [27].

    Взаимодействие между генетическими факторами хозяина, такими как MHC, и кишечной микробиотой и его влияние на развитие ревматоидного артрита трудно изучать у людей из-за высокой изменчивости генетических факторов и диеты [11].Исследование, проведенное Gomez et al. [68] представили первую демонстрацию того, что гены HLA и кишечная среда взаимодействуют, влияя на предрасположенность к артриту. Это исследование показало различия в фекальном микробиоме восприимчивых к ревматоидному артриту трансгенных мышей HLA-DRB10401 по сравнению с мышами DRB10402, устойчивыми к развитию ревматоидного артрита. В частности, микробный состав самок мышей DRB10401 значительно отличался от микробов самок DRB10402, и это приводило к увеличению проницаемости кишечника и транскриптов цитокинов типа Th27 у мышей DRB10401.Анализ показал, что кишечная флора мышей, предрасположенных к артриту, содержала большее количество Clostridium sp. бактерии, в то время как те из DRB10402, устойчивые к артриту, были обогащены семействами Porphyromonadaceae и Bifidobacteriaceae [68]. Последний микроорганизм был связан с противовоспалительным ответом в иммунной системе слизистой оболочки кишечника посредством подавления пролиферации Т-клеток и продукции провоспалительных цитокинов, а также путем ингибирования ядерного фактора kB.Результаты показывают разницу в микробном составе кишечника между двумя штаммами, предполагая, что гены MHC могут быть прямо или косвенно вовлечены в определение микробного состава кишечника и взаимодействия между кишечными комменсалами [13, 18]. Кроме того, они продемонстрировали, что дисбиоза недостаточно, так как для него требуется генетическая предрасположенность хозяина из-за неспособности индукции воспалительной реакции у диких животных даже при наличии проартритогенной кишечной флоры [13, 28].

    За последние десятилетия было проведено несколько исследований, пытавшихся связать воспаление слизистой оболочки кишечника и суставов. Эрола и др. [69] сообщили, что фекальный профиль жирных кислот бактериальных клеток значительно отличался у пациентов с ревматоидным артритом, в основном за счет анаэробных бактерий, по сравнению с контрольной группой. Они поддерживают идею о том, что ревматоидный артрит представляет собой состояние хронического воспаления, которое может быть мотивировано или усугублено чрезмерным ростом патогенных бактерий или недостатком обычных иммуномодулирующих бактерий [5, 16, 18, 57, 70].Вахтовуо и др. [16] также описали различия в разнообразии фекалий у лиц с ревматоидным артритом по сравнению с пациентами с фибромиалгией, характеризующиеся нижними бактериями Bundi, Bacteroides-Porphyromonas-Prevotella , подгруппой Bacteroides fragilis и группой Eubacterium rectale-Clostridium coccoides. у пациентов с ревматоидным артритом [6]. С другой стороны, Ньюкирк и соавт. [71] выявили различия в типах колонизации возбудителя E. coli у лиц с ревматоидным артритом, у РФ-позитивных пациентов чаще наблюдалась колонизация E.coli , филогенетическая группа D, в то время как RF-негативные пациенты чаще были колонизированы E. coli , филогенетической группой B2, и эти люди также имели более низкие баллы суставов и маркеры воспаления, но более высокие ответы антител IgA против E. coli . .

    Наблюдение за тем, что кишечная микробиота отличается у пациентов с ранним ревматоидным артритом по сравнению с контрольной группой, возобновило интерес к изучению кишечной микробиоты как возможного места возникновения аутоиммунных процессов; исследования, оценивающие кишечную микробиоту, показывают, что ревматоидный артрит характеризуется увеличением и/или уменьшением бактериальных групп по сравнению с контролем [5, 18, 55–57].Высокопроизводительное секвенирование образцов стула в 5 исследованиях пациентов с РА показало дисбактериоз кишечника [5, 18, 55, 57, 63], а в 2 исследованиях сообщалось о чрезмерном размножении Prevotella sp. у больных ранним РА, особенно P. copri (табл. 2) . Различия между бактериями, о которых сообщалось в исследованиях, могут зависеть от течения заболевания во времени (т. е. раннее или установленное), субъектов, включенных в контрольные группы (здоровые или родственники первой степени родства), получаемого лечения и географического положения, так как исследования не показывают ту же закономерность.

    913 МЛ возрастные группы: метавозрастные.
    7 7 родственников

    Автор (год издания) Проектирование Субъекты включены Метод, использованный Результаты в группе РА по сравнению с контрольной

    Shinebaum ЕТ др. [70] Случай-контроль 25 пациентов с РА по сравнению с контролем Оценка количества бактерий в фекальной культуре Значительно более высокая частота носительства Clostridium perfringens в популяции РА, чем в контрольной группе (88% против 48%, ).Количество кишечных палочек также было выше
    Eerola et al. [69] Случай-контроль 74 ранее не получавших лечения РА и 91 контрольная группа без РА Газожидкостная хроматография бактериальных CFA Изменение профиля CFA при РА по сравнению с контрольной группой, вероятно, вызванное анаэробными бактериями
    Vaahtovuo et al. [16] Случай-контроль 50 человек с РА и 50 человек с фибромиалгией Проточная цитометрия, гибридизация 16S рРНК и окрашивание ДНК Группа Prevotella , подгруппа Bacteroides fragilis и Eubacterium rectal Clostridium coccoides группа
    Toivanen et al.[57] Случай-контроль 25 ранее не получавших лечения пациентов с ранним РА и 23 контрольных пациента, страдающих от боли невоспалительного характера Prevotella и родов Porphyromonas , чем в контроле (4,7% против 9,5%, ). Количество бактерий, принадлежащих к группе Bacteroides-Prevotella-Porphyromonas , было в среднем у пациентов с РА вдвое меньше, чем в контроле
    Scher et al.[18] Поперечное исследование 44 пациента с РА, ранее не получавших лечения, 26 пациентов, получавших лечение РА, 16 пациентов с псориатическим артритом и 28 здоровых лиц из контрольной группы %) численность и снижение Bacteroides
    Liu et al. [56] Случай-контроль 15 человек с ранним РА и 15 здоровых Количественная ПЦР в реальном времени Фекальная микробиота больных РА содержала значительно больше Lactobacillus (10.62 ± 1,72 копий/г), чем в контрольной группе (8,93± 1,60 копий/г)
    Zhang et al. [5] Когорта 77 ранее не получавших лечения лиц с РА и 80 неродственных здоровых лиц контрольной группы; 17 человек, ранее не получавших лечения, с РА в паре с 17 здоровыми родственниками; Метагеномное дробовое секвенирование и исследование метагеномных ассоциаций Кишечник ревматоидного артрита был обогащен грамположительными бактериями и обеднен грамотрицательными бактериями, в том числе некоторыми протеобактериями и грамотрицательными бактериями. Firmicutes семейства Veillonellaceae.MLG, обогащенные RA, образовали большой кластер, включающий бактерий Clostridium asparagiforme , Gordonibacter pamelaeae , Eggerthella lenta и бактерий Lachnospiraceae. Наблюдалась тенденция к увеличению численности P. copri в зависимости от продолжительности РА в первый год
    Maeda et al. [63] Поперечное исследование 25 ранее не получавших лечения пациентов с ранним РА и 23 здоровых в контрольной группе Глубокое секвенирование на основе 16S рРНК В субпопуляции ранних пациентов с РА в микробиоте кишечника преобладали Prevotella copri
    Чен и др.[55] Случай-контроль 40 Субъекты с РА, получавшие лечение 16S рибосомная ДНК Увеличение числа прочтений из филума Actinobacteria в группе РА (0,45 по сравнению с 0,04%) 5 3 контрольных 1 степени с АР и 17 здоровых лиц) Уменьшение Faecalibacterium и экспансия Collinsella aerofaciens и Eggerthella lenta

    Тойванен и др. [57] сравнили фекальную микробиоту 25 пациентов с ранним РА с микробиотой пациентов с невоспалительной болью с использованием олигонуклеотидного зонда против 16S РНК. У пациентов с ранним РА было значительно меньше бактерий, принадлежащих к роду Bacteroides sp., Prevotella sp. и Porphyromonas sp. В другом исследовании Scher et al. [18] сообщили, что люди с ранним РА с большей вероятностью содержат Prevotella copri по сравнению с контрольной группой.Кроме того, они продемонстрировали, что пероральное введение P. copri усиливало местную воспалительную реакцию в мышиной модели колита. Таким образом, P. copri изменяет кишечную проницаемость. Такое увеличение может привести к проникновению бактерий и/или их компонентов по всему телу; это один из предполагаемых механизмов, связывающих дисбиоз с патогенезом артрита. Интересно, что относительное обилие P. copri показало отрицательную корреляцию с наличием общего эпитопа, предполагая, что состав кишечного микробиома человека также может частично зависеть от генома хозяина, и предполагая наличие дисбактериоза до появления клинических признаков. фенотип.

    В соответствии с этими результатами Maeda et al. [63] наблюдали, что P. copri в изобилии присутствовали в микробиоте кишечника у японских пациентов с ранним РА, которые не получали медикаментозного лечения. Они определили, что P. copri сам по себе обладал высокой способностью индуцировать связанные с клетками Th27 цитокины, такие как IL-6 и IL-23. Увеличенный Prevotella sp. обилие связано с усиленным воспалением слизистой оболочки, опосредованным Т-хелперами 17 типа, что согласуется с отмеченной способностью Prevotella sp.в управлении иммунными ответами Th27 in vitro [51]. В другом исследовании Pianta et al. [72] определили, что подгруппы пациентов с ревматоидным артритом имеют дифференциальную иммунную реактивность IgG или IgA с P. copri. Как у пациентов с впервые выявленным ревматоидным артритом, так и у пациентов с хроническим ревматоидным артритом в подгруппе были выявлены ответы антител IgA либо на Pc-p27, либо на весь организм, что коррелировало с ответами цитокинов Th27 и частыми ACPA. Вторая подгруппа имела антитела IgG P. copri , которые ассоциировались с ДНК Prevotella в синовиальной жидкости, P.copri -специфические ответы Th2 и менее частые ACPA. Пациенты с РА имели IgA, IgG или не имели специфических антител, что указывает на то, что у отдельных пациентов могут развиваться различные иммунные реакции на P. copri , что, в свою очередь, может иметь значение для риска заболевания и исходов.

    Молекулярная мимикрия из-за сходства последовательностей между чужеродным и собственным пептидом является одним из таких механизмов, который, как известно, приводит к перекрестной активации аутореактивных Т- или В-клеток патогенного происхождения.Эти Т- и В-клетки могут перекрестно реагировать с эпитопами хозяина, что приводит к аутоиммунитету [67]. В недавней работе Pianta et al. [73] описали два белка, полученных из распространенных типов кишечных бактерий, которые могут вызывать иммунный ответ у пациентов с РА. N -Ацетил-глюкозамин-6-сульфатаза (GNS) и филамин A (FLNA) были идентифицированы как аутоантигены, вызывающие ответы как Т-, так и В-клеток, более чем у 50% пациентов с РА, но не у здоровых людей из контрольной группы или у пациентов с другие ревматические заболевания.Представленный HLA-DR пептид GNS имеет выраженную гомологию последовательностей с эпитопами сульфатазных белков Prevotella sp. и Parabacteroides sp., тогда как пептид FLNA, представленный HLA-DR, имеет гомологию с эпитопами из белков Prevotella sp. и Butyricimonas sp., еще один кишечный комменсал. Ответы Т-клеток на соответствующие микробные и собственные пептиды сильно коррелировали. Это исследование предоставляет доказательства того, что эпитопы Т-клеток родственного порядка кишечных микробов, в частности Prevotella sp., могут перекрестно реагировать с собственными эпитопами белков с высокой экспрессией в суставах, особенно у пациентов с аллелями SE.

    Кроме того, Prevotella sp. может быть не единственным родом, участвующим в воспалительном заболевании. Чжан и др. [5] использовали технологию метагеномного дробового секвенирования для анализа образцов фекалий, зубов и слюны у большой когорты пациентов с РА, а также у здоровых людей. Анализ дифференциально представленных групп метагеномного сцепления выявил значительные различия микробиома между пациентами с РА и здоровым контролем не только в фекальных, но и в слюнных и стоматологических образцах.Они продемонстрировали, что грамположительные бактерии обогащают микробиоту по сравнению с небольшим количеством грамотрицательных бактерий и, кроме того, что дисбиоз связан с маркерами воспаления и клинической активностью ревматоидного артрита. Кроме того, они также обнаружили изменения в окислительно-восстановительной среде, транспорте и метаболизме железа, серы и цинка в микробиоте пациентов с РА, что указывает на то, что измененный микробиом может играть важную роль в патогенезе РА. Примечательно, что измененный микробиом частично восстанавливался до нормы (микробиом здоровых людей) у пациентов, у которых наблюдалось клиническое улучшение после назначения базисных противоревматических препаратов.Примечательно, что P. copri у лиц, пораженных РА, показали тенденцию к увеличению относительной численности в первый год, что согласуется с сообщениями об их увеличении при раннем РА. Многие видов Prevotella были обогащены слюной субъектов РА по сравнению с контрольной группой. Одним заметным исключением была Prevotella intermedia , которая была обогащена в контрольной группе. Однако в образцах зубного налета наблюдалась совершенно иная картина, и большинство Prevotella sp. присутствовали в более высоких пропорциях у здоровых испытуемых.

    Чен и др. [55] сообщили, что бактерии, принадлежащие к типу Actinobacteria , играют значительную роль в патогенезе ревматоидного артрита, Collinsella sp. и Eggerthella sp. предсказали его наличие, а дисбактериоз в кишечном микробиоме частично восстанавливается после лечения базисными противоревматическими препаратами, как и в предыдущем исследовании. Потенциальная ассоциация P. copri , о которой сообщалось ранее, с новым началом нелеченного РА и DR4 не наблюдалась в этой когорте пациентов с РА (в отличие от предыдущих исследований, все пациенты в настоящем исследовании в настоящее время находились на лечении).Они показали, что снижение микробного разнообразия кишечника у пациентов с РА связано с длительностью заболевания после поправки на различные препараты, используемые для лечения. Collinsella sp. может способствовать развитию ревматоидного артрита за счет молекулярной мимикрии, поскольку он представляет последовательности, общие с DRB10401. Роль ассоциированных с РА бактерий Collinsella sp. был подтвержден с использованием линии эпителиальных клеток человека и гуманизированной мышиной модели артрита. Collinsella sp.повышенная тяжесть заболевания на модели гуманизированных мышей. Одним из механизмов, с помощью которого Collinsella способствует патогенезу заболевания, является повышение проницаемости кишечника, о чем свидетельствует более низкая экспрессия белков плотных контактов. Кроме того, Collinsella влияет на продукцию эпителием IL-17A [55].

    Хотя исследования на субъектах с ревматоидным артритом показывают корреляцию Prevotella sp. в его патогенезе другие исследования предполагают, что его можно считать полезным видом бактерий, а не патогенным [74, 75].Коллекции культур в настоящее время включают около 40 различных видов Prevotella , большинство из которых являются оральными изолятами, а три из них обнаруживаются в кишечнике ( P. copri , как правило, более многочисленны). Совершенно разные репертуары геномных генов штаммов внутри и между Prevotella sp. и между хозяевами, вероятно, лежат в основе некоторых различий, наблюдаемых в реакциях на уровне рода на диету и состояние здоровья у разных особей [75]. Недавнее всестороннее исследование, сравнивающее несколько видов бактерий, предполагает, что принадлежность к определенному типу не предсказывает иммунологические свойства, подчеркивая важность характеристики свойств на видовом уровне.Мариэтта и др. [76] оценили способность 2 видов Prevotella sp. для профилактики и лечения артрита у мышей HLA-DQ8. Было показано, что способность модулировать иммунный ответ различалась между штаммами Prevotella . Лечение P. histicola подавляло развитие артрита за счет модулирования иммунного ответа (регуляция дендритных клеток и образование клеток Treg), что приводило к подавлению ответов Th27 и снижению воспалительных цитокинов (IL-2, IL-17 и некроза опухоли). фактор).Напротив, введение P. melaninogenica не показало значительного изменения уровней цитокинов, а также предотвращения развития артрита. Способность P. histicola к модуляции была подтверждена с использованием мышиной модели DBA/1, демонстрируя, что у мышей, получавших P. histicola , развивался более легкий артрит по сравнению с контрольной группой. Понятно, что единственный штамм Prevotella sp. может действовать так, как это интерпретируется как полезное или вредное, в зависимости от контекста.Это может объяснить, почему Prevotella sp. распространен в здоровой микробиоте и предполагает, что только определенные штаммы могут проявлять патогенные свойства.

    У пациентов с впервые выявленным РА обилие Prevotella в кишечнике происходило за счет Bacteroides fragilis , организма, важного для функции Treg [18, 72]. Фактически, высокие уровни P. copri и подобных видов связаны с низким уровнем полезных микробов, которые, как полагают, подавляют иммунную систему и метаболизируют витамины в формах, всасываемых в кровоток [17].При обсуждении возможных механизмов влияния диеты на ревматоидный артрит следует учитывать влияние кишечной флоры [77–79]. Диета, богатая белком и животными жирами, связана с присутствием Bacteroides sp. в то время как диета, богатая углеводами, связана с присутствием Prevotella sp. [80]. Исследования показали, что средиземноморская или веганская диета снижает воспалительную активность, повышает физическую активность и повышает жизненный тонус [19]. Тем не менее, некоторые другие исследования обнаруживают преимущества без достижения значительного улучшения составных показателей для измерения активности заболевания [81, 82].Тем не менее, в этих исследованиях не было установлено, действительно ли улучшение состояния при ревматоидном артрите было связано с изменением состава кишечной флоры.

    Пробиотики — это живые организмы, которые могут принести пользу здоровью хозяина. Пробиотики в основном оказывают свое благотворное влияние посредством следующих трех методов: антимикробного действия, повышения целостности слизистого барьера и иммуномодуляции [83]. Исследования [84–86], оценивающие взаимосвязь между приемом пробиотиков и уровнем активности РА, не дали убедительных результатов (таблица 3).Улучшения пробиотических вмешательств не были достаточно очевидными, чтобы продемонстрировать эффективность лечения пациентов с РА из-за ограниченного количества исследований. Необходимо провести более тщательно спланированные исследования, чтобы определить лучшие виды, которые облегчают ревматоидный артрит, и оптимизировать метод приема и дозы пробиотиков [83].

    Результаты

    Автор (год издания) Дизайн населения и вмешательство

    Хатакка и др.[89] Клинические испытания Группа Lactobacillus (). Группа плацебо () Не было статистически значимых различий в: CRP, СОЭ, IL-6, IL-10, IL-12 и HAQ
    Pineda et al. [86] Клиническое исследование 15 субъектов Lactobacillus rhamnosus GR-1 и Lactobacillus reuteri RC-14 вводили в течение 3 месяцев по сравнению с 14 субъектами в контрольной группе Пробиотики статистически не улучшали процент ответа ACR 20 (20 % против 7%, )
    Alipour et al.[84] Клиническое исследование 22 субъекта с Lactobacillus casei по сравнению с 24 субъектами с плацебо Статистически значимое снижение уровня СРБ, количества воспаленных и болезненных суставов и DAS-28
    Vagh . [85] Клиническое исследование 22 субъекта с Lactobacillus casei по сравнению с 24 субъектами с плацебо (мальтодекстрин) болезненные суставы и в DAS-28

    СРБ: С-реактивный белок; DAS28: показатель активности заболевания — 28; ИЛ: интерлейкин; СОЭ: скорость оседания эритроцитов; ACR: Американский колледж ревматологии.

    Наконец, доказательства того, что микробиота кишечника мотивирует развитие артрита, получены в экспериментальных моделях на мышах. У людей эта ассоциация основана на различиях между микробиомами в группах сравнения, которые не обязательно отражают ее причинно-следственную связь. Результаты, полученные на людях, позволяют предположить, что дисбактериоз является значимым этиологическим фактором, способствующим прогрессированию ревматоидного артрита, или даже более того, что воспаление, вызванное некоторыми микроорганизмами, такими как P. copri , вероятно, может способствовать поддержанию артрита.Чтобы предсказать роль кишечной микробиоты в патогенезе ревматоидного артрита, по-прежнему необходимо точное понимание потенциала этого вида, его экологии и взаимодействия с другими микробами и/или хозяевами. Кроме того, хотя слизистая оболочка кишечника обладает, вероятно, самым высоким потенциалом для взаимодействия хозяин-микроб, все слизистые оболочки имеют резидентную микробиоту и динамически реагируют на ее присутствие с помощью иммуномодуляции. Грамотрицательные бактерии могут вызывать инфекции в любой части тела; среди наиболее распространенных типов — оральный, стоматологический, плевропульмонарный, внутрибрюшной, генитальный слизистый, кожи и мягких тканей.Другими словами, это не означает, что все пациенты с ревматоидным артритом должны иметь дисбиоз в одном месте.

    6. Микробиота как возможный механизм профилактики ревматоидного артрита

    Текущие исследовательские проекты сосредоточены на профилактике с помощью биологических препаратов, которые ингибируют образование антител или активируют Т-клетки [87]. Недавние открытия показали, что кишечный дисбактериоз является большим шагом вперед в нашем понимании ревматоидного артрита. Тем не менее, нет исследований, демонстрирующих антиген или антигены, запускающие аутоиммунный процесс.Логические признаки указывают на то, что дисбиоз слизистых оболочек является привлекательным местом для выяснения путей аутоиммунитета, особенно механизмов, вызывающих потерю иммунной толерантности, и специфических механизмов, посредством которых человек переходит от доклинического заболевания к клиническому.

    Было показано, что микробиота кишечника играет роль в развитии ревматоидного артрита, хотя механизм этой связи остается неясным. Понимание этих механизмов имеет решающее значение для повышения эффективности лечения и персонализированного ведения пациентов [67].Пластичность микробиома может позволить специфическое или систематическое манипулирование определенной кишечной микробиотой, связанной с заболеваниями хозяина [88], предполагая, что в будущем это манипулирование может изменить терапевтические стратегии у субъектов с ревматоидным артритом.

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов в отношении публикации данной статьи.

    Благодарности

    Авторы благодарят Глорию Меркадо за ее полезные комментарии во время подготовки этой рукописи.

    «Кишечный дисбактериоз – новая цель лечения в профилактике колоректального рака» Флоринела-Андрада Думитру, Серджиу Иоан Мику и соавт.

     

    Авторов

    Флоринела-Андрада Dumitru , Чрезвычайная больница Констанца, Департамент гастроэнтерологии, Констанца, Румыния Следуйте
    Sergiu Ioan Micu , Аварийная больница Констанца, Департамент гастроэнтерологии, Констанца, Румыния
    Roxana Emanuela Popoiag , Университет Овидиуса, факультета медицины, Константы, Румыния
    Marilena Musat , Аварийная больница Констанца, Департамент гастроэнтерологии, Констанца, Румыния
    Andreea Daniela Caloian , Аварийная больница Констанца, Департамент онкологии, Констанца, Румыния
    Валентин CALU , Carol Davila Университет Медицина и фармацевтики, Департамент хирургии, Бухарест, Румыния
    Влад Денис Константин , Кэрол Давила Университет Медицина и фармацевтики, Департамент общей хирургии, Бухарест, РУМЫНИЯ Подписаться
    Даниэла Gabriela Balan , Carol Davila Университет Медицина и аптеки, факультет стоматологической медицины, Бухарест, Румыния
    Cornelia Nitipir , Cornelia Nitipir , Carol Davila Университет Медицина и фармацевки Элиаса, Департамент онкологии, Бухарест, Румыния Следуйте
    Florin Enache , БОЛЬНИЦА СКОРОЙ ПОМОЩИ КОНСТАНТЫ, ОТДЕЛЕНИЕ ДЕТСКОЙ ХИРУРГИИ, КОНСТАНТА, РУМЫНИЯ

    ДОИ

    10.22543/7674.82.П221228

    Аннотация

    Микробиом желудочно-кишечного тракта содержит не менее 100 триллионов микроорганизмов (бактерий, вирусов, грибков), распространение которых варьируется от рта до прямой кишки в пространственном и временном отношении на протяжении всей жизни. Микробиом выигрывает от продвижения исследований из-за его важной роли в здоровье человека. Исследования показывают, что его функциями являются иммунитет, метаболические процессы и слизистый барьер. Нарушения этих функций, дисбиоз, влияют на физиологию, приводят к диабету, воспалительным заболеваниям кишечника, ожирению и онкогенезу толстой кишки.Третья наиболее распространенная форма рака, колоректальный рак, является результатом действия многих факторов и генов, и, хотя связь между дисбактериозом и этим типом рака плохо охарактеризована, было показано, что некоторые виды бактерий и их метаболиты играют решающую роль. при развитии колоректального рака. Кроме того, микробиота кишечника играет роль в воспалительной реакции и нарушениях иммунного процесса при прогрессировании колоректального рака. Некоторые новые технологии, такие как секвенирование метагенома, способствовали прогрессу, анализируя метаболический и генетический профиль микробиоты, раскрывая подробности о бактериальном составе, взаимодействиях с хозяином и таксономических изменениях.В этом обзоре обобщены исследования, касающиеся связи между кишечной микробиотой и колоректальным раком, нацеленные на новые терапевтические стратегии.

    Рекомендуемая ссылка

    Думитру, Флоринела-Андрада; Мику, Серджиу Иоанн; Попояг, Роксана Эмануэла; Мусат, Марилена; Калоян, Андреа Даниэла; Калу, Валентин; Константин, Влад Денис; Балан, Даниэла Габриэла; Нитипир, Корнелия; и Энахе, Флорин (2021) «Дисбактериоз кишечника – новая цель лечения в профилактике колоректального рака». Journal of Mind and Medical Sciences : Vol.8: Исс. 2, статья 8.
    DOI: 10.22543/7674.82.P221228
    Доступно по адресу: https://scholar.valpo.edu/jmms/vol8/iss2/8

    ЗАГРУЗКИ

    С 11 октября 2021 г.

    МОНЕТЫ

     

    Дисбактериоз кишечника | Потеря веса

    Если вы страдаете дисбактериозом кишечника, простой анализ крови даст нам данные, необходимые для оценки уровня проницаемости вашего пищеварительного тракта.Числовое значение будет присвоено для представления уровня дисбактериоза, и это число может быть переоценено, когда вы работаете над восстановлением желудочно-кишечного тракта.

    Кишечный дисбактериоз — это новый медицинский термин для обозначения дисбаланса кишечной флоры, концепция, впервые предложенная врачами-холистами и натуропатами. Но это не значит, что эта концепция нова; травники использовали эту идею с древних времен — Гиппократ обсуждал проблему кишечных токсинов еще в 400 г. до н.э. Думайте о мембранах, выстилающих тонкий и толстый кишечник, как о своем заднем дворе.В этой аналогии мембраны вашего кишечника представлены почвой, а бактерии «хорошего парня», населяющие ваш кишечный тракт, — травой. «Плохие парни» или неподходящие бактерии, дрожжи, черви или паразиты подобны росичке, которая может вторгнуться и захватить часть газона вашего кишечника. Всего учеными выявлено более 400 видов кишечной микрофлоры, число которых в средней кишечной среде исчисляется миллиардами и может измеряться фунтами. Хорошие парни производят полезные вещества, в том числе важные природные антибиотики и иммуностимулирующие химические вещества, а плохие парни могут производить канцерогены, органические амины и высокие уровни эндотоксинов (токсины, выбрасываемые в организм при гибели бактерий).Плохое пищеварение, неправильный выбор продуктов, воспаление, сырость, стресс и т. д. могут привести к дисбалансу кишечной флоры. В зависимости от характера инфекции, проблемы могут варьироваться от легких до крайне изнурительных.

    [/two_ Third][one_ Third_last][/one_ Third_last]
    Проблемы с дисбактериозом чрезвычайно распространены, особенно среди женщин, и неспособность правильно диагностировать и лечить их может привести к большим страданиям и разочарованиям. Чрезмерное употребление антибиотиков является распространенной причиной, но более сильные штаммы «супербактерий», которые сейчас существуют, могут попадать в организм разными путями — из-за низкой кислотности желудка, зараженных продуктов, чрезмерного употребления сахара и т. д.Основными симптомами обычно являются тяга к сахару, углеводам и хлебу, газы и вздутие живота (в меньшей степени или отсутствуют, если проблема бактериальная, а не дрожжевая или грибковая), а также ряд неприятных длительных проблем, особенно усталость, боли в мышцах и «мозговой туман». Однако, в зависимости от организма, любой из этих общих симптомов может проявляться в большей или меньшей степени. Эта изменчивость, зависящая от назойливых «тварей», часто является причиной пропуска диагнозов. Также могут возникать депрессия и хроническая усталость, что приводит к неправильной диагностике и лечению.Часто язык бледный или синий из-за кислородного голодания, вызванного дисбактериозом. Некоторые из рассматриваемых организмов становятся более активными ночью, и в этом случае симптомы значительно ухудшаются после пробуждения.

    По моему опыту, невылеченный дисбактериоз может быть причинным фактором множества сложных болезненных состояний, которые необходимо лечить и устранять в первую очередь для достижения хороших результатов в лечении основного состояния. К ним относятся, помимо прочего, проблемы со щитовидной железой, воспаление глаз, хронические заболевания полости рта и носовых пазух (иногда с красным жжением языка), кислотный рефлюкс, хронический вагинальный дрожжевой грибок, инфекции мочевыводящих путей или предстательной железы, хроническая усталость, различные формы гормонального истощения, нарушение сна. , увеличение веса (из-за сильной тяги к сладкому), пищевая аллергия, аутоиммунные заболевания, хронические проблемы с пищеварением, такие как колит, СРК, запор и/или диарея, фибромиалгия, кожные заболевания, такие как экзема, акне, кожный зуд и крапивница, проблемы с печенью, головные боли (в том числе хронические), дисбаланс прогестерона и эстрогена и связанные с этим проблемы с гормонами, проблемы с астмой, изменения артериального давления, отрыжка, неприятный запах изо рта и инфекции полости рта, грибок ногтей на ногах, боли в суставах, снижение полового влечения, усталость после еды и многие другие.

    Как плохие парни заражают ваш кишечный газон

    Некоторые из наиболее распространенных «плохих парней» включают дрожжи (Candida albicans), Klebsiella, Proteus, H. pylori, Giardia, Pseudomonas, Citrobacter и Cryptosporidia и другие. Дисбактериоз часто возникает после длительных периодов слабого или нарушенного пищеварения. Когда пищеварение нарушено, уровень соляной кислоты, пепсина или пищеварительных ферментов поджелудочной железы низкий, и они не могут стерилизовать пищу, когда она попадает в организм. Как это часто бывает с пожилыми пациентами, это позволяет крабовому сорняку начать засевать ваш кишечник.

    Другие причины кишечного дисбиоза включают ослабленный иммунитет, изменения рН кишечника, инфекции и воздействие химических веществ. Тонкий кишечник обычно относительно свободен от чрезмерного бактериального роста, но плохие парни также могут колонизировать эту область. По мере усиления аномального брожения начинают проявляться такие симптомы, как газы, вздутие живота и диарея. Со временем, когда слизистый барьер разрушается, токсины попадают в кровоток, и могут появиться симптомы аллергии, потеря ясности ума, умеренная или сильная усталость, воспаление и мышечная боль.Это очень реальная и разочаровывающая проблема для пациентов, которую обычные врачи часто упускают из виду. В тяжелых случаях это может быть даже изнурительно. Например, как я уже говорил, это одна из скрытых причин синдрома хронической усталости.

    Чрезмерное использование антибиотиков может уничтожить популяцию бактерий «хороших парней», что создаст благоприятную среду для роста росички «плохих парней». Молочницу и подобные кишечные инфекции часто легко диагностировать, когда у пациентов выделяется необычно высокий уровень газов, что часто приводит к резкому растяжению желудка.Эти инфекции также могут привести к тому, что пациенты просыпаются ночью с чувством сильного жара, как если бы они испытывали длительные приливы. Тепло, выделяемое вредными организмами, также может воспламенять и сушить кишечник, вызывая запор.

    Хорошие парни дают отпор

    Бактерии хорошего парня, особенно Lactobacillus acidophilus, Bifidobacteria и Escherichia coli, обычно населяют толстую кишку. Эти виды бактерий использовались в качестве лекарств (в форме таблеток) с момента открытия их полезных свойств в 1908 году.Они традиционно содержатся в ферментированных продуктах, таких как йогурт и суп мисо, и исторически их хвалят за многочисленные преимущества для здоровья.

    Лактобациллы и бифидобактерии прикрепляются к клеткам кишечного эпителия и способствуют равновесию кишечной флоры. Поскольку они положительно действуют, их называют пробиотиками (против жизни), а не антибиотиками (против жизни). Они помогают конъюгировать желчные кислоты и противодействовать другим бактериям, особенно вредным, которые могут привести к токсемии кишечника, предвестнику кожных заболеваний, рака, усталости и различных форм воспалений.Они также снижают заболеваемость кишечными инфекциями, диареей и инфекциями мочевыводящих путей (ИМП).

    [стиль разделителя=”1″ выравнивание=”центр” размер=”нормальный” вариант=”нормальный” размер=”1px” цвет=”#D30056″ прокруткатекст=””]Политики[/divider]
    Пожалуйста, предоставьте любезность позвоните, чтобы отменить по крайней мере за 24 часа.

    Добавить комментарий

    Ваш адрес email не будет опубликован.