Смесь с пребиотиками: ПРЕБИОТИКИ В ДЕТСКИХ МОЛОЧНЫХ СМЕСЯХ | Ванденплас

Содержание

Пребиотики в детских молочных смесях Текст научной статьи по специальности «Фундаментальная медицина»

Обзор литературы

И. Ванденплас1, И.Н. Захарова2, Ю.А. Дмитриева2

1 Педиатрическая гастроэнтерология, UZ Brussel, Свободный университет Брюсселя, Бельгия

2 Российская медицинская академия последипломного образования, Москва, Российская Федерация

Пребиотики в детских молочных смесях

Контактная информация:

Ванденплас Иван (Vandenplas Yvan), профессор, UZ Brussel, Свободный университет Брюсселя

Адрес: Ларбеклан 101, 1090, Брюссель, Бельгия, тел.: + 32-2-47-57-80, e-mail: [email protected]

Статья поступила: 12.12.2014 г., принята к печати: 06.02.2015 г.

Микробиота желудочно-кишечного тракта отличается у младенцев, находящихся на грудном вскармливании, и у детей, получающих стандартные молочные смеси. В то время как материнское молоко богато пребиотическими олигосахаридами, а также может содержать некоторые пробиотики, стандартная детская смесь не содержит ни того, ни другого. В рецептуре детских смесей используют различные пребиотические компоненты: галакто- и фруктоолигосахариды, полидекстрозу и их сочетания. Имеются свидетельства того, что добавление пребиотиков в детское питание позволяет приблизить микробиоту желудочно-кишечного тракта младенцев, получающих молочные смеси, к микробиоте детей, находящихся на грудном вскармливании. Пребиотики изменяют метаболическую активность микрофлоры кишечника (снижают pH стула, увеличивают содержание короткоцепочечных жирных кислот), оказывают бифидо-генное воздействие и обеспечивают консистенцию стула и частоту дефекации, приближенную к этим параметрам у младенцев, находящихся на грудном вскармливании. Существуют немногочисленные свидетельства того, что такие изменения микробиоты желудочно-кишечного тракта могут оказывать определенное влияние на становление иммунной системы ребенка. Нежелательные явления при применении пребиотиков регистрируют чрезвычайно редко. Ключевые слова: грудное вскармливание, младенцы, галактоолигосахариды, молочная смесь, пребиотики. (Вопросы современной педиатрии. 2015; 14 (1): 31-37)

31

ВВЕДЕНИЕ

Пребиотические олигосахариды — один из самых важных компонентов материнского молока, в то время как в коровьем молоке они практически отсутствуют [1]. Олигосахариды грудного молока представляют собой сложную смесь гликановых соединений. Пребиотики являются неперевариваемыми ингредиентами пищевых продуктов, которые, попадая в желудочно-кишечный тракт (ЖКТ), способны стимулировать рост и/или активность кишечной микрофлоры, оказывая благоприятные эффекты на состояние здоровья человека. Хорошо известно, что микробиоценоз ЖКТ у младенцев, находящихся на грудном вскармливании, и детей, получающих стандартные детские смеси, развивается по-разному [2]. В составе материнского и коровьего молока имеется множество факторов, которые способствуют подобным различиям: например, содержание

углеводов, белков, железа и фосфора. Микробиота ЖКТ может считаться самостоятельным органом, обеспечивающим трофические функции, регуляцию ангиогенеза в кишечнике, защиту от патогенных микроорганизмов и становление иммунного ответа [1, 3].

Концепция диетической модуляции микрофлоры толстой кишки человека при помощи пребиотиков была разработана около 20 лет назад [4]. В составе детских смесей используют главным образом галакто- (ГОС) и фруктоолигосахариды (ФОС) и/или полидекстрозу. ГОС, наиболее приближенные по структуре к олигосахаридам грудного молока, продемонстрировали способность поддерживать функциональное состояние ЖКТ и обеспечивать становление иммунной системы [5]. Такие же свойства были обнаружены и у фруктанов ину-линового типа [1]. Пребиотический эффект определяется как «селективная стимуляция роста и/или активности

I. Vandenplas1, I.N. Zakharova2, Yu.A. Dmitrieva2

1 Paediatric Gastroenterology, UZ Brussels, Free University of Brussels, Belgium

2 Russian Medical Academy of Postgraduate Education, Moscow, Russian Federation

Prebiotics in Infant Formulas

Microbiota of the gastrointestinal tract is different in breastfed infants and in children receiving standard infant formulas. While breast milk is rich in prebiotic oligosaccharides and can also contain some probiotics, standard infant formulas contain neither one thing nor the other. The formulation of an infant formula includes various prebiotic ingredients: galacto- and fructooligosaccharides, polydextrose and their combinations. There is evidence that the addition of prebiotics to baby food makes the microbiota of the gastrointestinal tract of infants receiving infant formulas more similar to the microbiota of breastfed children. Prebiotics alter the metabolic activity of the intestinal microflora (lower stool pH and increase the amount of short-chain fatty acids), have a bifidogenic effect and provide a stool consistency and bowel movement frequency that are similar to these parameters in breastfed infants. There is limited evidence that such changes in microbiota of the gastrointestinal tract may have some influence on the development of an infant’s immune system. Adverse events are extremely rare in the application of prebiotics.

Key words: breast feeding, infants, galacto-oligosaccharides, milk formula, prebiotics.

(Voprosy sovremennoi pediatrii — Current Pediatrics. 2015; 14 (1): 31-37)

Обзор литературы

32

одного или ограниченного количества представителей микробиоценоза кишечника, которые оказывают благоприятный эффект на состояние здоровья хозяина» [6].

ПРЕБИОТИКИ И БИФИДОГЕННЫЙ ЭФФЕКТ,

МЕТАБОЛИЧЕСКАЯ АКТИВНОСТЬ МИКРОФЛОРЫ

КИШЕЧНИКА И КОНСИСТЕНЦИЯ СТУЛА

Известно, что пребиотики оказывают бифидогенное воздействие на микробиоту ЖКТ хозяина. Аналогичный эффект характерен для некоторых белков (сывороточные белки, а-лактальбумин), лактозы, жировых соединений (р-пальмитат), а также обусловлен низким содержанием железа и фосфора в грудном молоке [7].

ПРЕБИОТИКИ И БАКТЕРИАЛЬНЫЙ СОСТАВ

МИКРОБИОТЫ ЖЕЛУДОЧНО-КИШЕЧНОГО ТРАКТА

Воздействие пребиотиков на кишечную микробиоту было подтверждено в нескольких клинических исследованиях. В частности, показано, что молочные смеси, содержащие сочетание ГОС, ФОС и полидекстрозы, с большей вероятностью будут оказывать воздействие на микроорганизмы кишечника, если их применение было начато в первые месяцы жизни [8]. Короткоцепочечные пребиотики ферментируются главным образом в слепой и восходящих отделах ободочной кишки, в то время как длинноцепочечные олигосахариды — на всем протяжении толстой кишки.

В другом исследовании 68 бактериальных штаммов, представляющих собой 29 лактобактерий, выделенных у человека, и 39 бифидобактерий (как человеческого, так животного происхождения) были протестированы на предмет их способности метаболизировать 10 различных углеводов [9]. Синтетические среднецепочечные ГОС, содержащие большое количество лактозы и галактозы, продемонстрировали аналогичную способность к утилизации микроорганизмами Bifidobacterium longum, как и олигосахариды грудного молока [10]. Было показано, что именно ГОС и лактулоза поддерживают наиболее благоприятные характеристики роста, в то время как относительно слабый рост лакто- и бифидобактерий отмечался при добавлении инулина, мальтодекстрина и полидекстрозы [9]. Эти результаты, а также другие недавние исследования подтверждают целесообразность использования смесей, обогащенных ГОС, для достижения бифидогенного эффекта.

При сравнении молочных смесей, содержащих 50% олигофруктозы/50% ФОС (0,4 или 0,8 г/дл) или ГОС/ФОС 90:10 (0,8 г/дл), и стандартной смеси, было обнаружено, что бактериальный состав микрофлоры кишечника у младенцев, получавших первые два продукта, был приближен к таковому у детей, находившихся на грудном вскармливании [11].

Ряд исследователей также продемонстрировали, что смесь с добавлением ФОС способна оказывать положительное воздействие на развитие микробиоты кишечника у недоношенных младенцев [12]. Здоровые недоношенные младенцы, находящиеся на искусственном вскармливании, были рандомизированы в течение первых 14 сут после рождения для вскармливания либо стандартной детской смесью для недоношенных, либо аналогичной смесью с добавлением ФОС (0,4 г/100 мл). Было показано, что количество бифидобактерий в фекалиях и доля «колонизированных» младенцев были достовер-

но выше в исследуемой группе. Применение молочной смеси, обогащенной ФОС, кроме того, сопровождалось значимым уменьшением количества Escherichia coli и Enterococcus в фекалиях младенцев [11]. Аналогичные результаты были получены при изучении эффекта молочных смесей, обогащенных ГОС и ГОС/ФОС, в сравнении со стандартной смесью в отношении параметров роста младенцев и соотношения представителей бифидобактерий и клостридий в составе микробиоценоза кишечника [13, 14]. Исследователями было продемонстрировано, что в группе детей в возрасте 6 нед, получавших пребиотические продукты, содержание бифидобактерий в кале было недостоверно выше, чем в группе сравнения, в то время как содержание клостри-дий в кишечнике младенцев группы исследования было достоверно ниже [14].

Стимулирующее воздействие на рост бифидобактерий пребиотиков ГОС/ФОС в составе детских молочных смесей подтверждено рядом исследований [13, 15-18]. P. A. Scholtens и соавт. установили, что абсолютное количество и доля бифидобактерий в фекалиях младенцев, вскармливаемых смесью с добавлением ГОС/ФОС, были сопоставимы с таковыми у младенцев, находившихся на грудном вскармливании [14]. В другом исследовании вскармливание младенцев в течение 26 нед смесью, обогащенной короткоцепочечными ГОС в концентрации 6 г/л и длинноцепочечными ФОС (в пропорции 9:1), способствовало достоверному увеличению доли бифидобактерий в кале у детей исследуемой группы (60,4%) по сравнению с контролем (52,6%; р = 0,04). Доля Clostridium spp. в составе микробиоценоза составила 0,0 и 3,27%, соответственно (р = 0,006) [17]. В исследуемой группе доля детей с высевом Clostridium difficile была также достоверно ниже, чем в группе сравнения: 45,2 и 63,3%, соответственно (р = 0,037) [15].

Смеси, обогащенные ГОС, также продемонстрировали положительный эффект в отношении роста лактобактерий в кишечнике [16, 17]. X. M. Ben и соавт. в своей работе показали, что применение частично гидролизованной детской смеси с добавлением пребиотика и грудное вскармливание способствовали формированию у младенцев близкой по составу и количественным характеристикам микробиоты кишечника [16]. В другом исследовании 159 здоровых младенцев в возрасте 4-6 мес, находившихся на искусственном вскармливании, были рандомизированы для вскармливания молочной смесью с добавлением ГОС в концентрации 5 г/л (n = 77) или стандартной молочной смесью (контрольная группа, n = 82) [19]. Установлено, что добавление ГОС в питание оказывает положительное воздействие на рост бифидобактерий у младенцев в период введения прикорма [19]. В ходе недавно проведенного многоцентрового рандомизированного двойного слепого плацебоконтро-лируемого исследования у 365 доношенных младенцев выявили, что добавление ГОС в концентрации 0,4 г/дл в молочную смесь для детей первого полугодия жизни и 0,5 г/дл в молочную смесь для вскармливания детей старше 6 мес способствует росту бифидобактерий и уменьшению количества C. difficile в составе микробиоценоза кишечника [15]. По результатам количественной полимеразной цепной реакции наиболее распространенным видом микроорганизмов в кале младенцев, получавших обогащенный пребиотиками продукт, были

Bifidobacterium breve, так же как и у младенцев, находившихся на грудном вскармливании [15]. Эти данные сопоставимы с результатами других исследователей, которые оценивали эффективность комбинации полидекстрозы и ГОС. D. M. Scalabrin и соавт. продемонстрировали, что количественный состав микрофлоры младенцев при вскармливании обогащенными молочными смесями был сходен с таковым при грудном вскармливании. В основной группе на 30-й день исследования отмечалось более высокое содержание общего количества бифидобактерий (р = 0,069) и представителей B. longum (р = 0,057) по сравнению с контролем, а также достоверно более высокое количество Bifidobacterium infantis (р = 0,002). При оценке состава микробиоценоза на 60-й день исследования общее количество бифидобактерий и представителей B. longum на фоне вскармливания смесью с пробиотиками было достоверно выше [20]. При использовании методов флуоресцентной гибридизации in situ и полимеразной цепной реакции достоверного прироста содержания бифидобактерий в кале младенцев обеих групп в период с 30-го по 60-й день и достоверных различий в общем количестве бифидобактерий зарегистрировано не было. При этом обращал на себя внимание значительный прирост количества B. infantis между 0-м и 30-м и B. longum — между 0-м и 60-м днем, достоверно более высокий в исследуемой группе (р < 0,035) [20].

R. N. Fedorak и соавт. в своем исследовании зафиксировали отсутствие каких-либо локальных или системных побочных эффектов на фоне применения пробиотических олигосахаридов [19]. В исследовании G. E. Walton и соавт. было показано, что применение ГОС значительно увеличило количество бифидобактерий in vivo и in vitro у женщин и мужчин в возрасте старше 50 лет [21].

Считается, что пребиотики способны устранять нарушения микробиоты кишечника, вызванные антибиотиками [22]. Исследование S. E. Ladirat и соавт. позволило сравнить воздействие ГОС на состав и активность микробиоты кишечника взрослых после лечения антибактериальными препаратами [22]. Авторами показано, что пребиотический эффект ГОС на фоне терапии зависит от типа антибиотика и его дозировки [22].

ПРЕБИОТИКИ И pH ФЕКАЛИЙ

Известно, что у детей, находящихся на грудном вскармливании, и детей, получающих молочную смесь, обогащенную пребиотиками, pH фекалий ниже, чем у младенцев при вскармливании стандартной молочной смесью [14]. Смеси, обогащенные ГОС в концентрации 0,24 и 0,44 г/100 мл, и грудное молоко обеспечивают сопоставимые значения pH фекалий [15, 23]. Важно отметить, что pH содержимого кишечника модулирует состояние микрофлоры, ингибируя или способствуя росту различных популяций бактерий. В частности, низкий кишечный pH приводит к уменьшению числа патогенных микроорганизмов [24].

ПРЕБИОТИКИ И МЕТАБОЛИЧЕСКАЯ АКТИВНОСТЬ

Вскармливание младенцев молочной смесью, содержащей комбинацию ГОС/ФОС или только ГОС, оказывает воздействие на метаболическую активность микробиоты, аналогичное грудному молоку [13, 15, 25, 26]. Изменение продукции короткоцепочечных жирных кислот и лактата на фоне применения смесей с пребиотиками отража-

ет ферментативную активность микрофлоры, сравнимую с таковой при вскармливании грудным молоком [13]. Поскольку содержание короткоцепочечных жирных кислот в кале связано с метаболической активностью микробиоценоза кишечника [26], можно утверждать, что микрофлора у младенцев, которые получают смесь, обогащенную пребиотиками, развивается таким же образом, как и при грудном вскармливании.

B. Rodriguez-Colinas и соавт. в своем исследовании продемонстрировали, что основной кислотой, выявляемой при анализе кала младенцев, получавших обогащенную смесь, является уксусная, образование которой связано с метаболизмом бифидобактерий [27]. Воздействие ГОС на кишечную метаболическую активность было выявлено в ходе еще одного недавно проведенного исследования, которое указало на значительное увеличение в кале у младенцев, вскармливаемых обогащенной смесью, общего содержания короткоцепочечных жирных кислот, повышение содержания уксусной кислоты и снижение концентрации масляной и пропионовой кислот, что характерно для детей на грудном вскармливании [15].

ПРЕБИОТИКИ И КОНСИСТЕНЦИЯ СТУЛА

По сравнению с младенцами, вскармливаемыми стандартными молочными смесями, у детей, получавших смесь, обогащенную пребиотиками, консистенция стула была более мягкой, сходной с таковой у младенцев, находившихся на грудном вскармливании [28]. Показано, что различные концентрации ГОС (0,24 и 0,4 г/100 мл) в молочных смесях способствуют повышению частоты стула [15-17]. Молочные смеси, предназначенные для младенцев старше 6 мес, содержащие ГОС в концентрации 0,5 г/дл, также способствовали более высокой частоте и мягкой консистенции стула [15]. D. M. Scalabrin и соавт. подтвердили, что у младенцев, получавших в течение 60 дней смесь, обогащенную комплексом полидекстроза/ГОС (4 г/л, в пропорции 1:1), более мягкий по сравнению с контрольной группой стул отмечался на протяжении всего исследования [20]. При этом применение комплекса пребиотиков не провоцировало повышенного газообразования. Различия в консистенции стула у детей сохранялись на протяжении 120 дней наблюдения [28].

В работе N. M. Mugambi была оценена переносимость смеси различных пребиотиков. Продемонстрировано, что пребиотики способствовали увеличению частоты стула при отсутствии воздействия на его консистенцию, не увеличивали частоту возникновения колик, срыги-ваний и рвоты, беспокойства и плача у младенцев [29]. При сравнении комбинаций олигофруктоза/ФОС (0,4 или 0,8 г/дл, соотношение 1:1), ГОС/ФОС (0,8 г/дл, 9:1) и стандартной смеси было установлено, что консистенция стула у младенцев, получавших смесь, обогащенную ГОС/ФОС (0,8 г/дл), приближалась к таковой, наблюдаемой при грудном вскармливании [11].

В 2009 г. был опубликован систематический обзор, в котором обобщены данные рандомизированных контролируемых исследований по эффективности использования обогащенных пребиотиками молочных смесей. Результаты анализа продемонстрировали, что частота стула у детей на фоне применения пребиотиков не отличалась от таковой при грудном вскармливании и была значительно выше по сравнению с младенца-

33

ВОПРОСЫ СОВРЕМЕННОЙ ПЕДИАТРИИ /2015/ ТОМ 14/ № 1

Обзор литературы

34

ми, получавшими стандартную молочную смесь [30]. Аналогичные результаты были получены и в отношении консистенции стула [30]. В исследовании P. Piemontese и соавт., включившем 1130 младенцев, консистенция стула в группе детей, получавших обогащенное пре-биотиком питание, была мягче по сравнению с контролем через 8, 16 и 24 нед наблюдения и приближалась к характеристикам в группе детей, находившихся на грудном вскармливании [31].

ПРЕБИОТИКИ И ОБЩЕЕ СОСТОЯНИЕ ЗДОРОВЬЯ

Влияние пребиотиков на различные физиологические функции в организме изучали в большом числе как экспериментальных, так и клинических исследований. Так, E. F. dos Santos и соавт. продемонстрировали, что ГОС способствовали снижению интенсивности выделения кальция с фекалиями у здоровых крыс и животных, подвергшихся гастрэктомии, и таким образом предотвращали развитие остеопении [32]. P. Alliet и соавт. при исследовании холестеринового обмена у младенцев показали, что добавление в молочную смесь комбинации короткоцепочечных ГОС и длинноцепочечных ФОС (0,6 г/100 мл в пропорции 9:1) не снижало сывороточной концентрации холестерина у детей, однако его уровень у младенцев, получавших молочную смесь, был значительно ниже по сравнению с детьми, находившимися на грудном вскармливании [33]. В открытом клиническом исследовании с участием 342 здоровых младенцев, в ходе которого оценивали эффективность шестимесячного применения стандартной детской смеси в сравнении с молочной смесью, обогащенной ГОС/ФОС, в основной группе было отмечено меньше случаев острого гастроэнтерита по сравнению с контролем (0,12 ± 0,4 и 0,29 ± 0,5 эпизода на одного ребенка, соответственно; р = 0,015), а также снижение риска возникновения более чем трех эпизодов гастроэнтерита за год (17/60 и 29/65, соответственно; р = 0,06). Необходимость использования антибактериальной терапии за год исследования в основной группе также была достоверно ниже (24/60 и 43/65, соответственно; р = 0,004) [34]. В исследованиях S. Arslanoglu и соавт. установлено, что вскармливание смесью, обогащенной смесью короткоцепочечных ГОС и длинноцепочечных ФОС, приводит к достоверному уменьшению числа диагностированных инфекционных эпизодов, лихорадки, а также достоверно уменьшает необходимость использования антибиотиков с момента начала вскармливания вплоть до двухлетнего возраста [35, 36]. Результаты представленных исследований свидетельствуют, что раннее начало применения смеси, обогащенной пребиотиками, способно защитить младенца от развития инфекционных заболеваний [35].

Следует отметить, что в других рандомизированных клинических исследованиях эти результаты подтверждены не были. Так, в ходе крупного рандомизированного двойного слепого плацебоконтролируемого клинического исследования с участием 830 здоровых доношенных младенцев, проведенного в 7 центрах 5 западноевропейских стран, не было подтверждено влияния пребиотиков в стандартных молочных смесях на частоту эпизодов лихорадки [37]. Эти результаты сопоставимы с результатами недавнего рандомизированного двойного слепого плацебоконтролируемого клинического исследования, в котором оценивали эффективность смеси, обогащен-

ной ГОС. В ходе исследования не было зафиксировано каких-либо различий как в частоте развития у младенцев инфекционной диареи или необходимости назначения антибактериальной терапии, так и в частоте аллергических проявлений вплоть до двенадцатимесячного возраста [15]. Неоднородность результатов можно объяснить в т. ч. популяционными различиями. Так, в недавнем исследовании все участники были здоровыми доношенными младенцами, проживавшими в среде с низким риском развития инфекционных заболеваний. Это определило необходимость в проведении дополнительных исследований в популяциях с высокой частотой возникновения инфекционных болезней (возможно, в развивающихся странах), а также дальнейшее изучение влияния пребиотиков на частоту формирования аллергических проявлений у младенцев с высоким риском развития атопии [15].

ПРЕБИОТИКИ И РОСТ

Влияние пребиотиков на рост детей изучали в нескольких исследованиях. В частности, в работе E. Bruzzese и соавт. обнаружено, что после 6 мес наблюдения происходило временное увеличение массы тела у детей, получавших смеси с пребиотиками, по сравнению с контрольной группой [34]. В других исследованиях продемонстрировано, что пребиотики в составе детских смесей способствовали увеличению массы тела при отсутствии эффекта на динамику роста или окружности головы [14, 29]. Следует отметить, что достоверность полученных результатов может подвергаться сомнению по причине неоднородности используемых методов оценки физического развития, различных смесей исследуемых пре-биотиков, а также ввиду предпочтительной публикации положительных результатов исследований [29].

Увеличение среднего веса, роста и окружности головы, а также толщины кожной складки и окружности плеча на фоне грудного вскармливания было зафиксировано в ходе многоцентрового рандомизированного двойного слепого плацебоконтролируемого клинического исследования, включившего 1130 здоровых доношенных младенцев [36]. Толщина кожной складки у детей на грудном вскармливании в возрасте 8 нед была заметно больше по сравнению с младенцами, получавшими молочную смесь, в то время как к 52-й нед это различие становилось менее заметным [36].

В других исследованиях подобных различий в параметрах роста зафиксировано не было [14, 35, 37]. Так, M. van Stuijvenberg и соавт. при сравнении смеси, обогащенной пребиотиками, со стандартной детской смесью не установили каких-либо различий в скорости роста в период с 14-х по 120-е сут наблюдения [37]. Вместе с тем было показано, что переносимость детской смеси, обогащенной ФОС/ГОС, была отличной [14, 35, 37]. По данным систематического обзора, проведенного в 2009 г., в 10 публикациях оценивалось воздействие пребиотиков на рост в течение первого года жизни [38]. Ни в одном исследовании не было выявлено достоверных различий, однако у младенцев, получавших обогащенную детскую смесь, отмечали несколько большие темпы прироста массы тела [38]. Эти результаты сопоставимы с данными, недавно полученными C. Sierra и соавт., которые также не показали влияния пребиотиков на рост младенцев [15].

ПРЕБИОТИКИ И ИММУННЫЕ ПАРАМЕТРЫ

Бифидофлора может способствовать постнатальному созреванию иммунной системы и таким образом обеспечивать защиту от инфекций и аллергии. О наличии корреляции между количеством бифидобактерий и уровнем секреторного иммуноглобулина (sIg) A в кишечнике известно уже в течение многих лет [39, 40]. Кроме того, существуют данные о том, что инулин и олигофруктоза способны модулировать иммунологические процессы на уровне ассоциированной с кишечником лимфоидной ткани, что играет важную роль для младенцев, а также пациентов с воспалительными заболеваниями кишечника [41]. Эффект, связанный с применением пребиотиков и наблюдаемый после прекращения их использования, указывает на то, что изменение кишечной микробиоты оказывает иммуномодулирующее влияние в организме младенцев [35].

Как уже отмечалось, изучение влияния современных детских смесей на развитие иммунной системы является одним из приоритетных направлений исследований. Положительное воздействие на развитие иммунной системы оказывают длинноцепочечные полиненасыщенные жирные кислоты и нуклеотиды. Эффекты различных соединений обычно суммируются, что создает трудности в определении роли каждого отдельного компонента. В качестве примера можно привести одно рандомизированное клиническое исследование по оценке эффективности молочной смеси с добавлением ГОС (в концентрации 0,44 и 0,5 г/100 мл, соответственно) в сочетании с длинноцепочечными полиненасыщенными жирными кислотами и нуклеотидами [15]. В исследовании M. Raes было показано, что младенцы, вскармливаемые молочной смесью с добавлением комбинации короткоцепочечных ГОС и длинноцепочечных ФОС (0,6 г/100 мл в пропорции 9:1), имели сходные иммунные параметры в возрасте 8 и 26 нед при сравнении с контролем [42]. Полученные результаты позволили заключить, что смесь пребиотических олигосахаридов не вызывает изменений исходных параметров развивающейся иммунной системы у здоровых младенцев по сравнению с младенцами, получавшими стандартную детскую смесь, или детьми, находившимися на исключительно грудном вскармливании [42, 43]. В исследовании X. M. Ben и соавт. вскармливание младенцев в течение 26 нед смесью, обогащенной комбинацией короткоцепочечных ГОС и длинноцепочечных ФОС, приводило к более высокой концентрации sIgA (719 мкг/г) по сравнению с показателем у детей контрольной группы (263 мкг/г). При этом концентрация sIgA у младенцев из группы грудного вскармливания была сопоставима с таковой в исследуемой группе [17]. Также M. Raes и соавт. установили, что применение ГОС способно уменьшить выраженность признаков колита у мышей посредством модуляции функции и направленной миграции NK-клеток [42].

В исследовании E. van Hoffen и соавт. продемонстрировано, что вскармливание младенцев смесью, обогащенной ГОС/ФОС, способствовало снижению активности иммунного ответа на белок коровьего молока, не затрагивая при этом поствакцинальный ответ [44]. C. Sierra и соавт. по результатам многоцентрового рандомизированного контролируемого исследования, проведенного с участием 365 младенцев, показали, что на фоне вскармливания смесью с ГОС отмечается снижение

концентрации sIgA, аналогичное таковому у детей при использовании стандартной смеси. [15]. D. M. Scalabrin и A. M. Bakker-Zierikzee обнаружили более высокие, чем в предыдущем исследовании, уровни sIgA у младенцев, получавших смеси, обогащенные комбинациями преби-отиков полидекстроза/ГОС [20] и ГОС/ФОС [45]. В то же время авторы установили, что снижение уровня sIgA было более стабильным с течением времени у младенцев, которые получали смесь, содержащую ГОС, и сопоставимым с тем, которое отмечалось у младенцев, находившихся на грудном вскармливании [20, 45]. Все эти факты позволяют сделать предположение о возможном влиянии пребиотиков на становление местного иммунитета в кишечнике.

ПРЕБИОТИКИ, АЛЛЕРГИЯ И АТОПИЧЕСКИЙ

ДЕРМАТИТ

В исследовании B. Schouten показано, что преби-отики снижают концентрацию компонентов реагинов у младенцев с повышенным риском развития аллергии [46]. В экспериментальных условиях было показано, что ГОС препятствует возникновению кожных поражений по типу атопического дерматита у мышей посредством активации выработки интерлейкина (ИЛ) 10 и подавления выработки ИЛ 17, ассоциированного с развитием воспалительных заболеваний кожи [47].

В крупном исследовании с участием 259 детей в возрасте 6 мес с повышенным риском развития аллергии добавление пребиотика в детскую смесь снижало частоту развития атопического дерматита [48]. Несмотря на результаты отдельных исследований, систематические обзоры не смогли подтвердить эффективность пребиотиков в отношении профилактики атопического дерматита [49]. С другой стороны, установлено, что раннее добавление олигосахаридов в пищу снижает вероятность развития аллергических реакций у детей группы риска. Такой защитный эффект в отношении атопического дерматита и аллергического риноконъюнктивита имеет долгосрочный характер и сохраняется вплоть до 5-го года жизни [49, 50].

По данным отдельных лабораторных исследований продемонстрировано, что специфическая комбинация короткоцепочечных ГОС и длинноцепочечных ФОС снижает выраженность аллергической реакции на яичный альбумин у мышей [50]. Теми же авторами показано, что использование ГОС/ФОС в составе продуктов питания, вероятно, дает возможность переключать иммунный ответ в сторону Тх1-типа и ингибировать иммунологические реакции, обусловленные Тх2, ведущие к развитию аллергических болезней [51].

Эффективность применения пребиотиков изучали на животной модели с оценкой маркеров иммунологической толерантности (IgG2a, IgA, ИФН 7, ТФР р, ИЛ 10), аллергического воспаления (IgE, IgG1, ИЛ4, ИЛ 17) и состояния кишечной микробиоты (пропионат, MyD88) [52]. Вне зависимости от диеты у сенсибилизированных мышей отмечались аналогичные концентрации IgE, IgG1, СD23, ИЛ 4, ИЛ 17, а также аналогичные симптомы аллергии [53]. Авторы установили, что вскармливание животных обогащенной пребиотиками смесью преимущественно стимулировало экспрессию биомаркеров иммунологической толерантности, не влияя на уровень маркеров аллергического воспаления [53].

35

ВОПРОСЫ СОВРЕМЕННОЙ ПЕДИАТРИИ /2015/ ТОМ 14/ № 1

Обзор литературы

Существует ряд исследований, свидетельствующих, что добавление пребиотика в смеси для младенцев может предотвратить развитие экземы [52]. В исследовании C. Gruber сообщается о снижении частоты возникновения атопического дерматита у младенцев из группы низкого риска по развитию аллергических заболеваний [54]. В то же время в других исследованиях не подтверждено влияния пребиотиков на риск возникновения аллергии [15].

Таким образом, вопрос эффективности применения пребиотиков для предотвращения аллергических заболеваний до настоящего времени остается открытым. Прежде чем возможно будет рекомендовать широкое использование пребиотиков для профилактики аллергии у детей, находящихся на искусственном вскармливании, необходимо проведение дополнительных исследований [38].

ЗАКЛЮЧЕНИЕ

Даже при отсутствии достаточных доказательств, свидетельствующих о необходимости добавления пребиотиков в состав молочных смесей для вскармливания доношенных младенцев, их применение считается полезным с клинической точки зрения [38]. Имеются свидетельства в пользу благоприятного воздействия пребиотиков в составе детских смесей на микробиоту кишечника, метаболическую активность кишечной микрофлоры, консистенцию и частоту стула, а также влияния на некоторые параметры иммунной системы. Поскольку пребиотики присутствуют в материнском молоке, по всей видимости, ничто не препятствует их добавлению в детские смеси, хотя, как отмечалось выше, доказательства клинической пользы все еще являются недостаточными. Будущие исследования должны быть сосредоточены на изучении специфичности и безопасности пребиотиков, их эффективных дозах и комбинациях.

КОНФЛИКТ ИНТЕРЕСОВ

Статья подготовлена при финансовой поддержке компании Hero Rus.

36

СПИСОК ЛИТЕРАТУРЫ

1. Kunz C., Rudloff S., Baier W., Klein N., Strobel S. Oligosaccharides in human milk: structural, functional, and metabolic aspects. Ann. Rev. Nutr. 2000; 20: 699-722.

2. Harmsen H. J., Wildeboer-Veloo A. C., Raangs G. C., Wagen-dorp A. A., Klijn N., Bindels J. G., Welling G. W. Analysis of intestinal flora development in breast-fed and formula-fed infants by using molecular identification and detection methods. J. Pediatr. Gastroenterol. Nutr. 2000; 30: 61-7l.

3. Johnson C. L., Versalovic J. The human microbiome and its potential importance to pediatrics. Pediatrics. 2012; 129: 950-960.

4. Gibson G. R., Roberfroid M. B. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 1995; 125: 1401-1412.

5. Zakharova I. N., Dmitrieva Yu. A. Pre- and probiotics in infant formulas. Pediatrics. Suppl. to Consilium medicum. 2011; 3: 20-24.

6. Roberfroid M., Gibson G. R., Hoyles L., McCartney A. L., Ras-tall R., Rowland I., Wolvers D., Watzl B., Szajewska H., Stahl B., Guarner F., Respondek F., Whelan K., Coxam V., Davicco M. J., Leotoing L., Wittrant Y., Delzenne N. M., Cani P. D., Neyrinck A. M., Meheust A. Prebiotic effects: metabolic and health benefits. Brit. J. Nutr. 2010; 104 (Suppl. 2): 1-63.

7. Yaron S., Shachar D., Abramas L., Riskin A., Bader D., Litmanovitz I., Bar-Yoseph F., Cohen T., Levi L., Lifshitz Y., Shamir R., Shaoul R. Effect of high р-palmitate content in infant formula on the intestinal microbiota of term infants. J. Pediatr. Gastroenterol. Nutr. 2013; 56: 376-381.

8. Nakamura N., Gaskins H. R., Collier C. T., Nava G. M., Rai D., Petschow B., Russell W. M., Harris C., Mackie R. I., Wampler J. L., Walker D. C. Molecular ecological analysis of fecal bacterial populations from term infants fed formula supplemented with selected blends of prebiotics. Appl. Environ. Microbiol. 2009; 75: 1121-1128.

9. Watson D., O’Connell Motherway M., Schoterman M. H., van Neerven R. J., Nauta A., van Sinderen D. Selective carbohydrate utilization by lactobacilli and bifidobacteria. J. Appl. Microbiol. 2013; 114: 1132-1146.

10. Gonzalez R., Klaassens E. S., Malinen E., de Vos W. M., Vaughan E. E. Differential transcriptional response of Bifidobacterium longum to human milk, formula milk, and galactooligosaccharide. Appl. Environ. Microbiol. 2008; 74: 4686-4694.

11. Kapiki A., Costalos C., Oikonomidou C., Triantafyllidou A., Pertrohilou V. The effect of a fructo-oligosaccharide supplemented formula on gut flora of preterm infants. Early Hum. Dev. 2007; 83: 335-339.

12. Costalos C., Kapiki A., Apostolou M., Papathoma E. The effect of a prebiotic supplemented formula on growth and stool microbiology of term infants. Early Hum. Dev. 2008; 84: 45-49.

13. Knol J., Scholtens P, Kafka C., Steenbakkers J., Gro S., Helm K., Klarczyk M., Schopfer H., Bockler H. M., Wells J. Colon microflora in infants fed formula with galacto- and fructo-oligosaccharides: more like breast-fed infants. J. Pediatr. Gastroenterol. Nutr. 2005; 40: 36-42.

14. Scholtens P. A., Alliet P., Raes M., Alles M. S., Kroes H., Boehm G., Knippels L. M., Knol J., Vandenplas Y. Fecal secretory immunoglobulin A is increased in healthy infants who receive a formula with short-chain galacto-oligosaccharides and long-chain fructo-oligosaccharides. J. Nutr. 2008; 138: 1141-1147.

15. Sierra C., Bernal M. J., Blasco J., Martinez R., Dalmau J., Ortuno I., Espin B., Vasallo M. I., Gil D., Vidal M. L., Infante D., Leis R., Maldonado J., Moreno J. M., Roman E. Prebiotic effect during the first year of life in healthy infants fed formula containing GOS as the only prebiotic: a multicentre, randomised, double-blind and placebo-controlled trial. Eur. J. Nutr. 2015; 54 (1): 89-99.

16. Ben X. M., Li J., Feng Z. T., Shi S. Y., Lu Y. D., Chen R., Zhou X. Y. Low level of galacto-oligosaccharide in infant formula stimulates growth of intestinal Bifidobacteria and Lactobacilli. World J. Gastroenterol. 2008; 14: 6564-6568.

17. Ben X. M., Zhou X. Y., Zhao W. H., Yu W. L., Pan W., Zhang W. L., Wu S. M., Van Beusekom C. M., Schaafsma A. Supplementation of milk formula with galacto-oligosaccharides improves intestinal micro-flora and fermentation in term infants. Chin. Med. J. 2004; 117: 927-931.

18. Rinne M. M., Gueimonde M., Kalliomaki M., Hoppu U., Salmi-nen S. J., Isolauri E. Similar bifidogenic effects of prebiotic-supple-mented partially hydrolyzed infant formula and breastfeeding on infant gut microbiota. FEMS Immunol. Med. Microbiol. 2005; 43: 59-65.

19. Fedorak R. N., Madsen K. I. Probiotics and prebiotics in gastrointestinal disorders. Curr. Opin. Gastroenterol. 2004; 20: 146-155.

20. Scalabrin D. M., Mitmesser S. H., Welling G. W., Harris C. L., Marunycz J. D., Walker D. C., Bos N. A., Tolkko S., Salminen S., Van-derhoof J. A. New prebiotic blend of polydextrose and galacto-oligosaccharides has a bifidogenic effect in young infants. J. Pediatr. Gastroenterol. Nutr. 2012; 54: 343-352.

21. Walton G. E., van den Heuvel E. G., Kosters M. H., Rastall R. A., Tuohy K. M., Gibson G. R. A randomised crossover study investigating the effects of galacto-oligosaccharides on the faecal microbiota in men and women over 50 years of age. Brit. J. Nutr. 2012; 107: 1466-1475.

22. Ladirat S. E., Schuren F. H., Schoterman M. H., Nauta A., Grup-pen H., Schols H. A. Impact of galacto-oligosaccharides on the gut microbiota composition and metabolic activity upon antibiotic treatment during in vitro fermentation. FEMS Microbiol. Ecol. 2014; 87: 41-51.

23. Ashley C., Johnston W. H., Harris C. L., Stolz S. I., Wampler J. L., Berseth C. L. Growth and tolerance of infants fed formula supplemented with polydextrose (PDX) and/or galactooligosaccha-rides (GOS): double-blind, randomized, controlled trial. Nutr. J. 2012; 11: 38.

24. Topping D. L., Clifton P M. Short-chain fatty acids and human colonic function: roles of resistant starch and nonstarch polysaccharides. Physiol. Rev. 2001; 81: 1031-1064.

25. Bakker-Zierikzee A. M., Alles M. S., Knol J., Kok F. J., Tolboom J. J., Bindels J. G. Effects of infant formula containing a mixture of galacto-and fructo-oligosaccharides or viable Bifidobacterium animalis on the intestinal microflora during the first 4 months of life. Brit. J. Nutr. 2005; 94: 783-790.

26. Zakharova I., Sugyan N., Ardatskaya M. Metabolic activity of intestinal microflora while antibacterial therapy. Abs. PO-G-0171 presented on 46th ESPGHNAN Annual Meeting. London. 2013.

27. Rodriguez-Colinas B., Kolida S., Baran M., Ballesteros A. O., Rastall R. A., Plou F. J. Analysis of fermentation selectivity of purified galacto-oligosaccharides by in vitro human faecal fermentation. Appl. Microbiol. Biotechnol. 2013; 97: 5743-5752.

28. Schmelzle H., Wirth S., Skopnik H., Radke M., Knol J., Bockler H. M., Bronstrup A., Wells J., Fusch C. Randomized doubleblind study of the nutritional efficacy and bifidogenicity of a new infant formula containing partially hydrolyzed protein, a high beta-palmitic acid level, and nondigestible oligosaccharides. J. Pediatr. Gastroenterol. Nutr. 2003; 36: 343-351.

29. Mugambi M. N., Musekiwa A., Lombard M., Young T., Blaauw R. Synbiotics, probiotics or prebiotics in infant formula for full term infants: a systematic review. Nutr. J. 2012; 11: 81.

30. Rao S., Srinivasjois R., Patole S. Prebiotic supplementation in full-term neonates: a systematic review of randomized controlled trials. Arch. Pediatr. Adolesc. Med. 2009; 163: 755-764.

31. Piemontese P., Gianni M. L., Braegger C. P., Chirico G., Gruber C., Riedler J., Arslanoglu S., van Stuijvenberg M., Boehm G., Jelinek J., Roggero P. MIPS 1 Working Group. Tolerance and safety evaluation in a large cohort of healthy infants fed an innovative prebiotic formula: a randomized controlled trial. PLoS One. 2011; 6: 28010.

32. dos Santos E. F., Tsuboi K. H., Araujo M. R., Andreollo N. A., Miyasaka C. K Dietary galactooligosaccharides increase calcium absorption in normal and gastrectomized rats. Rev. Col. Bras. Cir. 2011; 38: 186-191.

33. Alliet P., Scholtens P., Raes M., Hensen K., Jongen H., Rum-mens J. L., Boehm G., Vandenplas Y. Effect of prebiotic galacto-oligosaccharide, long-chain fructo-oligosaccharide infant formula on serum cholesterol and triacylglycerol levels. Nutrition. 2007; 23: 719-723.

34. Bruzzese E., Volpicelli M., Squeglia V., Bruzzese D., Salvini F., Bisceglia M., Lionetti P., Cinquetti M., Iacono G., Amarri S., Guarino A. A formula containing galacto- and fructo-oligosaccharides prevents intestinal and extra-intestinal infections: an observational study. Clin. Nutr. 2009; 28: 156-161.

35. Arslanoglu S., Moro G. E., Schmitt J., Tandoi L., Rizzardi S., Boehm G. Early dietary intervention with a mixture of prebiotic oligosaccharides reduces the incidence of allergic manifestations and infections during the first two years of life. J. Nutr. 2008; 138: 1091-1095.

36. Arslanoglu S., Moro G. E., Boehm G. Early supplementation of prebiotic oligosaccharides protects formula-fed infants against infections during the first 6 months of life. J. Nutr. 2007; 137: 2420-2424.

37. van Stuijvenberg M., Eisses A. M., Gruber C., Mosca F., Arslanoglu S., Chirico G., Braegger C. P, Riedler J., Boehm G., Sauer P J. Do prebiotics reduce the number of fever episodes in healthy children in their first year of life: a randomised controlled trial. Brit. J. Nutr. 2011; 106: 1740-1748.

38. Braegger C., Chmielewska A., Decsi T., Kolacek S., Mihatsch W., Moreno L., Piescik M., Puntis J., Shamir R., Szajewska H., Turck D., van Goudoever J. ESPGHAN Committee on Nutrition. Supplementation of infant formula with probiotics and/or prebiotics: a systematic review and comment by the ESPGHAN committee on nutrition. J. Pediatr. Gastroenterol. Nutr. 2011; 52: 238-250.

39. Fukushima Y., Kawata Y., Hara H., Terada A., Mitsuoka T. Effect of a probiotic formula on intestinal immunoglobulin A production in healthy children. Int. J. Food Microbiol. 1998; 42: 39-44.

40. Yasui H., Mike A., Ohwaki M. Immunogenicity of Bifidobacterium breve and change in antibody production in Peyer’s patches after oral administration. J. Dairy Sci. 1989; 72: 30-35.

41. Seifert S., Watzl B. Inulin and oligofructose: review of experimental data on immune modulation. J. Nutr. 2007; 137 (11; Suppl.): 2563-2567.

42. Raes M., Scholtens P. A., Alliet P., Hensen K., Jongen H., Boehm G., Vandenplas Y., Rummens J. L. Exploration of basal immune parameters in healthy infants receiving an infant milk formula supplemented with prebiotics. Pediatr. Allergy Immunol. 2010; 21: 377-385.

43. Gopalakrishnan A., Clinthorne J. F., Rondini E. A., McCaskey S. J., Gurzell E. A., Langohr I. M., Gardner E. M., Fenton J. I. Supplementation with galacto-oligosaccharides increases the percentage of NK cells and reduces colitis severity in Smad3-deficient mice. J. Nutr. 2012; 142: 1336-1342.

44. van Hoffen E., Ruiter B., Faber J., M’Rabet L., Knol E. F., Stahl B., Arslanoglu S., Moro G., Boehm G., Garssen J. A specific mixture of short-chain galacto-oligosaccharides and long-chain fructo-oligosaccharides induces a beneficial immunoglobulin profile in infants at high risk for allergy. Allergy. 2009; 64: 484-487.

45. Bakker-Zierikzee A. M., Tol E. A., Kroes H., Alles M. S., Kok F. J., Bindels J. G. Faecal SIgA secretion in infants fed on pre- or probiotic infant formula. Pediatr. Allergy Immunol. 2006; 17: 134-140.

46. Schouten B., Van Esch B. C., Kormelink T. G., Moro G. E., Arslanoglu S., Boehm G., Knippels L. M., Redegeld F. A., Willemsen L. E., Garssen J. Non-digestible oligosaccharides reduce immunoglobulin free light-chain concentrations in infants at risk for allergy. Pediatr. Allergy Immunol. 2011; 22: 537-542.

47. Tanabe S., Hochi S. Oral administration of a galactooligosac-charide preparation inhibits development of atopic dermatitis-like skin lesions in NC/Nga mice. Int. J. Mol. Med. 2010; 25: 331-336.

48. Moro G., Arslanoglu S., Stahl B., Jelinek J., Wahn U., Boehm G. A mixture of prebiotic oligosaccharides reduces the incidence of atopic dermatitis during the first six months of age. Arch. Dis. Child. 2006; 91: 814-819.

49. Williams H. C., Grindlay D. J. What’s new in atopic eczema? An analysis of systematic reviews published in 2007 and 2008. Part 2. Disease prevention and treatment. Clin. Exp. Dermatol. 2010; 35: 223-227.

50. Vos A. P, van Esch B., M’Rabet L., Folkerts G., Garssen J. Dietary supplementation with specific oligosaccharide mixtures decreases parameters of allergic asthma in mice. Int. Immunopharmacol. 2007; 6: 1277-1286.

51. Vos A. P., Haarman M., Buco A., Govers M., Knol J., Garssen J., Stahl B., Boehm G., M’Rabet L. A specific prebiotic oligosaccharide mixture stimulates delayed-type hypersensitivity in a murine influenza vaccination model. Int. Immunopharmacol. 2006; 6: 1277-1286.

52. Osborn D. A., Sinn J. K. Prebiotics in infants for prevention of allergy. Cochr. Database Syst. Rev. 2013; 3: CD006474.

53. Gourbeyre P., Desbuards N., Gremy G., Tranquet O., Champ M., Denery-Papini S., Bodinier M. Perinatal and postweaning exposure to galactooligosaccharides/inulin prebiotics induced biomarkers linked to tolerance mechanism in a mouse model of strong allergic sensitization. J. Agric. Food Chem. 2013; 61: 6311-6320.

54. Gruber C., van Stuijvenberg M., Mosca F., Moro G., Chirico G., Braegger C. P., Riedler J., Boehm G., Wahn U. MIPS 1 Working Group. Reduced occurrence of early atopic dermatitis because of immunoactive prebiotics among low-atopy-risk infants. J. Allergy Clin. Immunol. 2010; 126: 791-797.

37

ВОПРОСЫ СОВРЕМЕННОЙ ПЕДИАТРИИ /2015/ ТОМ 14/ № 1

Сухая молочная смесь Similac Gold 1 с пребиотиками 400г

Similac Молочная смесь 1 Gold с 0 мес. 400 г

1-я в России детская молочная смесь с олигосахаридами грудного молока 2′-FL – уникальным ингредиентом, укрепляющим иммунную систему, который ранее был обнаружен только в грудном молоке.

Олигосахариды 2′-FL стимулируют рост полезных бактерий в кишечнике, где находится 70% клеток иммунной системы. Бифидобактерии B.lactis – эффективный и хорошо изученный пробиотик, помогающий развитию здоровой микрофлоры кишечника и поддержанию здоровья пищеварительной системы.

Пребиотики FOS являются пищей для полезной микрофлоры кишечника, способствуют мягкому стулу. Нуклеотиды – строительный материал для ДНК всех клеток организма. Отсутствие пальмового масла способствует уменьшению запоров и более высокому усвоению кальция. Эффективность Similac Gold подтверждена клиническими исследованиями. Similac GOLD с новым олигосахаридом 2′-FL еще ближе к грудному молоку, чем когда-либо. Similac GOLD — для комфортного пищеварения и поддержки иммунитета ребенка (Меньше колик – меньше плача через неделю; Вдвое меньше инфекций). Все смеси Similac не содержат пальмовое масло, ГМО, красители,  консерванты  и глютен.

Состав Similac Gold 1: Обезжиренное молоко, лактоза, РАСТИТЕЛЬНЫЕ МАСЛА (высокоолеиновое подсолнечное масло, кокосовое масло, соевое масло), концентрат сывороточного белка, фруктоолигосахариды (ФОС), МИНЕРАЛЫ (калия цитрат, кальция карбонат, натрия цитрат, натрия хлорид, магния хлорид, железа (II) сульфат, цинка сульфат, кальциевые соли ортофосфорной кислоты, меди сульфат, марганца сульфат, йодид калия, селенит натрия), гидролизат сывороточного белка, арахидоновая кислота (АRA) из масла M.alpina, олигосахарид 2′-FL, ВИТАМИНЫ (витамин C, холин, ниацин, пантотеновая кислота, витамин А, витамин B1, витамин B6, фолиевая кислота, витамин К1, витамин B2, биотин, витамин D3, витамин В12), эмульгатор соевый лецитин, докозагексаеновая кислота (DHA) из масла C.cohnii, инозит, Bifidobacterium lactis (не менее 106 КОЕ/г), таурин, L-триптофан, НУКЛЕОТИДЫ (цитидин 5’-монофосфат, динатрия уридин 5’-монофосфат, аденозин 5’-монофосфат, динатрия гуанозин 5’-монофосфат), антиокислитель смесь токоферолов, L-карнитин, КАРОТИНОИДЫ (лютеин, бета-каротин).

Масса нетто – 400 гр.Срок годности – 24 месяцев.

Смесь сухая молочная Hipp 2 Combiotic с пребиотиками с 6 месяцев 600 г с бесплатной доставкой на дом из «ВкусВилл»

Описание: Последующая формула HiPP 2 Combiotic содержит необходимое для растущего организма ребенка количество витаминов, микроэлементов и питательных веществ и обеспечивает соответствующую возрастную калорийность.
Молочная смесь содержит:
• пробиотики грудного молока – живые лактобактерии l.fermentum, выделенные из грудного молока, ипребиотические пищевые волокна (галактоолигосахариды GOS), подобные содержащимся в грудном молоке
Клинически доказано**, что такое сочетание:
• способствует формированию естественного иммунитета ребенка и здоровой кишечной микрофлоры,
• усиливает защитные функции кишечника,
• обеспечивает комфортное пищеварение (профилактика младенческих колик и запоров)
• смесь Омега-3 и Омега-6 для гармоничного роста и развития
• нуклеотиды для усиления иммунной системы, защиты от инфекций и других заболеваний
• органическое молоко, благотворно влияющее на формирование иммунитета и снижение риска возникновения аллергии
Уважаемые покупатели! Для HiPP органика — это не тенденция, это отношение к жизни: создать и поддерживать мир, в котором стоит жить будущим поколениям. Это означает не только органическое производство, но и обеспечение максимально возможного уровня переработки отходов производства и упаковки.
Следуя этим принципам, мы приняли решение заменить нашу жестяную банку для молочной смеси HiPP Combiotic на премиальную картонную упаковку.
Новая упаковка HiPP Combiotic — экологично и удобно.
• Меньше выбросов углекислого газа, чем при использовании металлических банок
• Картонная коробка и пакет из фольги могут быть утилизированы отдельно
• Чернила на основе растительных масел. Без содержания минеральных масел
• Картон от ответственных производителей (FSC сертификат)
Такая упаковка лучше перерабатывается и не наносит вреда окружающей среде.
Коробка имеет удобный клапан для закрытия крышки, держатель для мерной ложки, специальный клапан для точной дозировки смеси и фиксирующий стикер для хранения открытого пакета.
Рекомендации по кормлению
Для питания детей раннего возраста предпочтительнее грудное вскармливание.
Адаптированная смесь HiPP 2 Combiotic может быть использована для искусственного вскармливания или в качестве дополнения к грудному молоку (смешанное вскармливание) с 6 месяцев, а также после окончания кормления грудным молоком или другой молочной смесью.
При переходе на HiPP 2 Combiotic, вы можете заметить изменение консистенции стула вашего ребенка, что характерно для продуктов, содержащих пребиотики, которые способствуют размягчению стула.
Условия хранения
Коробка содержит один индивидуальный пакет. После вскрытия используйте стикер на пакете, чтобы запечатать пакет, и закрывайте коробку крышкой.
Плотно закрывайте пакет после каждого использования и храните смесь в сухом темном месте при комнатной температуре (не выше +25 градусов С).
Открытый пакет необходимо использовать в течение 3 недель.
СПОСОБЫ ПРИМЕНЕНИЯ:
Приготовление
При приготовлении HiPP 2 Combiotic чётко придерживайтесь инструкции. Несоблюдение инструкции по приготовлению молочной смеси или хранение приготовленной молочной смеси в бутылочке может нанести вред здоровью ребенка. Не используйте оставшуюся после кормления молочную смесь повторно. Всегда готовьте свежую порцию смеси перед каждым кормлением и кормите ребенка сразу после приготовления смеси. Тщательно мойте бутылочку, соску и кольцо.
Не подогревайте молочную смесь в микроволновой печи (опасность перегрева!).
1) Для приготовления используйте кипяченую питьевую воду, охлажденную до 40-50 °С. Не разводите молочную смесь кипятком.
2) Добавьте необходимый объем воды (см. таблицу кормления) в бутылочку для кормления.
3) Наберите мерной ложкой сухую смесь, излишки удалите с помощью ограничителя. Рекомендуемое количество мерных ложек (см. таблицу кормления) смеси высыпьте в бутылочку.
4) Плотно закройте бутылочку и потрясите.
5) Охладите до температуры кормления (около 37 °C). Проверьте температуру!
Таблица кормления
Для каждого ребенка необходим индивидуальный подход в подборе режима и объемов кормлений. Ниже указаны примерные объемы готовой смеси и рекомендации по количеству кормлений в день. Ваш ребенок необязательно должен выпивать всю бутылочку.
Используйте только приложенную мерную ложечку.
Объем готовой смеси, млКипяченая вода, мл Мерные ложки
1701505
2001806
2352107
В 2020 году HiPP стал первым сертифицированным молочным заводом, не влияющим на климат при производстве.

Молочная смесь Бибиколь 1 с пребиотиками на основе козьего молока 400 г с 0-6 мес

Адаптированная сухая молочная смесь для детей от рождения до полугода. Изготовлена на основе натурального козьего молока из фермерских хозяйств Новой Зеландии. Подходит для детей с непереносимостью белков коровьего молока и риском развития пищевой аллергии.

Почему Нэнни?

Близость к женскому молоку. Молоко новозеландских коз по структуре белка ближе к женскому молоку, чем коровье.

Сбалансированность состава. В смесях НЭННИ есть все питательные компоненты, необходимые для полноценного роста и развития ребенка:

  • Сбалансированное количество белка снижает нагрузку на организм;
  • Жирные кислоты Омега-3 (DHA) и Омега-6 (ARA), важные для развития мозга и зрения ребенка;
  • Без подсластителей.
  • Единственный углевод – лактоза, природный молочный сахар, поддерживающий здоровую микрофлору кишечника.

 

Натуральность. Молочные смеси Нэнни производятся на основе натурального цельного козьего молока, и имеют мягкий сливочный вкус. Большинство важнейших компонентов, в том числе и нуклеотиды, содержатся в цельном козьем молоке естественным образом. Они сохраняются в процессе производства, и обогащают состав смесей Нэнни.

Экологическая чистота. Новая Зеландия – одна из самых экологически чистых стран в мире. В отличие от европейских коз, получающих зерновой комбикорм, новозеландские козочки в течение всего года питаются свежей травой. Именно поэтому их молоко, на основе которого создаются смеси Нэнни, так натурально и богато питательными веществами.

Особенности:

  • Возможность кормления детей с непереносимостью белков коровьего молока и риском развития пищевой аллергии;
  • Практически отсутствует один из основных аллергенов коровьего молока – α-s1-казеин;
  • Клинически доказанный лечебный и профилактический эффект;
  • 6 штук в коробке.

Смесь Нэнни 2 с пребиотиками (с 6 мес) 400 г x1

Адаптированная сухая молочная смесь для детей с 6 месяцев на основе натурального козьего молока.

ПРОДУКТ МОМЕНТАЛЬНОГО ПРИГОТОВЛЕНИЯ
для детского питания

ДЛЯ КОГО СОЗДАНЫ СМЕСИ НЭННИ:

•Для здоровых детей,
•Для детей с непереносимостью белков коровьего молока и риском развития пищевой аллергии.
СМЕСИ НЭННИ — 5 ФАКТОРОВ ОПТИМАЛЬНОГО ВЫБОРА:

•Близость к женскому молоку
Молоко новозеландских коз по структуре белка ближе к женскому молоку, чем коровье. Поэтому сухие смеси НЭННИ сделаны на его основе.
•Сбалансированность состава
В смесях НЭННИ есть все питательные компоненты, необходимые для полноценного роста и развития ребенка. Количество белка сбалансировано, чтобы снизить нагрузку на организм. Сухие смеси НЭННИ 2 дополнительно обогащены комплексами жирных кислот Омега-3 (DHA) и Омега-6 (ARA), так как они важны для развития мозга и зрения ребенка. Молочная смесь НЭННИ 2 также содержит комплекс пребиотиков Orafti® Synergy 1, нормализующий кишечную микрофлору, обеспечивающий профилактику запоров и мягкий регулярный стул. В смеси НЭННИ не добавляются подсластители.
•Натуральность
Сухая молочная смесь НЭННИ производится на основе натурального цельного козьего молока и имеет мягкий сливочный вкус. Смесь уникальна, так как большинство важнейших компонентов, в том числе и нуклеотиды, содержатся в цельном козьем молоке естественным образом и сохраняются в процессе производства.
•Экологическая чистота
Новая Зеландия — одна из самых экологически чистых стран в мире. Козочки, на основе молока которых созданы сухие смеси НЭННИ, в течение всего года питаются свежей травой, в отличие от европейских коз, получающих зерновые комбикорма.
•Возможность кормления детей с непереносимостью белков коровьего молока и риском развития пищевой аллергии
Лечебный и профилактический эффект смесей НЭННИ обусловлен природными свойствами козьего молока, в котором практически отсутствует один из основных аллергенов коровьего молока α-s1-казеин. Эффективность смесей НЭННИ в профилактике и лечении пищевой аллергии клинически доказана.
ПИЩЕВАЯ ЦЕННОСТЬ:

Основные компоненты На 100мл смеси На 100г порошка
Белки, в том числе г 1,6 12,0
Белки молочной сыворотки % 20 20
Жиры, в том числе (%) г 3,6 26,5
Линолевая кислота (к-та) (ω6) г 0,51 3,8
Альфа-линоленовая к-та г 0,058 0,43
Арахидоновая к-та (ω6) мг 8,7 65
Докозагексаеновая к-та (ω3) мг 8,1 60
Эйкозапентаеновая к-та (ω3) мг 1,7 13
Линолевая к-та (ω6) / сумма жирных к-т % 16 16
Углеводы, в том числе г 7,4 55,3
Лактоза г 5,8 43,3
Лактоза (содержание в углеводах) % 78 78
Мальтодекстрин г 1,1 8,3
Пребиотический комплекс (инулин, олигофруктоза) г 0,50 3,7
Зола г 0,46 3,4
Минеральные вещества
Кальций мг 66 490
Фосфор мг 51 380
Калий мг 83 620
Натрий мг 28 210
Магний мг 6,7 50
Медь мкг 50 370
Марганец мкг 4,3 32
Железо мг 0,74 5,5
Цинк мг 0,6 4,5
Йод мкг 9,4 70
Селен мкг 2,1 16
Витамины
Ретинол (А) мкг 54 400
Токоферол (Е) мг 0,82 6,1
Кальциферол (D) мкг 0,91 6,8
Витамин К мкг 4,2 31
Тиамин (В1) мкг 66 490
Рибофлавин (В2) мкг 99 740
Пантотеновая кислота мг 0,34 2,5
Пиридоксин (В6) мкг 47 350
Ниацин (РР) мг 0,7 5,2
Фолиевая кислота (Вс) мкг 7,5 56
Цианкобаламин (В12) мкг 0,17 1,3
Аскорбиновая к-та (С) мг 9,7 72
Биотин мкг 2,4 18
Таурин мг 4,6 34
Инозит мг 5,9 44
Холин мг 10 75
L-карнитин мг 1,2 9,2
Нуклеотиды мг 1,4 10
Осмоляльность мОсм/кг 310 310
Энергетическая ценность ккал 67 500

СОСТАВ:

Сухое цельное козье молоко, лактоза, растительные масла (подсолнечное, каноловое, кокосовое, высокоолеиновое подсолнечное), мальтодекстрин, пребиотический комплекс Orafti® Synergy 1 (инулин, олигофруктоза), инкапсулированный жир морских рыб (докозагексаеновая кислота, эйкозапентаеновая кислота), инкапсулированная арахидоновая кислота, хлорид холина, лецитин, триптофан, таурин, L-карнитин.

Минералы: цитрат натрия, гидроксид кальция, лимонная кислота, сульфат железа, сульфат цинка, сульфат меди, сульфат марганца, селенит натрия.

Витамины: аскорбиновая кислота, p-альфа-токоферол ацетат, ниацинамид, холекальциферол, концентрат смеси токоферолов, ретинол ацетат, кальция d-пантотенат, тиамина гидрохлорид, цианокобаламин, витамин К1, пиридоксина гидрохлорид, рибофлавин, фолиевая кислота, биотин.

Нэнни 2 с пребиотиками адаптированная сухая молочная смесь на основе козьего молока для детей с 6 месяцев 400 гр

НЭННИ ® 2 с пребиотиками

На основе НАТУРАЛЬНОГО козьего молока

Адаптированная сухая молочная смесь для детей с 6 месяцев

ПРОДУКТ МОМЕНТАЛЬНОГО ПРИГОТОВЛЕНИЯ для детского питания

Внешний вид и свойства:

Консистенция в сухом виде: Мелкий сухой порошок. Допускается наличие незначительного количества легко рассыпающихся комочков смеси при механическом воздействии.

Консистенция в восстановленном виде: Однородная жидкость, без посторонних включений

Вкус и запах: Чистый, свойственный молочной смеси, без посторонних запахов и вкусов

Цвет: От белого до кремового, не прозрачный. Допускается наличие оттенков добавленных компонентов

ДЛЯ КОГО СОЗДАНЫ СМЕСИ НЭННИ:

• Для здоровых детей;

• Для детей с непереносимостью белков коровьего молока и риском развития пищевой аллергии.

СМЕСИ НЭННИ — 5 ФАКТОРОВ ОПТИМАЛЬНОГО ВЫБОРА:

• Близость к женскому молоку

Молоко новозеландских коз по структуре белка ближе к женскому молоку, чем коровье. Поэтому смеси НЭННИ сделаны на его основе.

• Сбалансированность состава

В смесях НЭННИ есть все питательные компоненты, необходимые для полноценного роста и развития ребенка. Количество белка сбалансировано, чтобы снизить нагрузку на организм. Смесь НЭННИ 2 дополнительно обогащена комплексами жирных кислот Омега-3 (DHA) и Омега-6 (ARA), так как они важны для развития мозга и зрения ребенка. Смесь НЭННИ 2 также содержит комплекс пребиотиков Orafti® Synergy 1, нормализующий кишечную микрофлору, обеспечивающий профилактику запоров и мягкий регулярный стул. В смеси НЭННИ не добавляются подсластители.

• Натуральность

Молочные смеси НЭННИ производятся на основе натурального цельного козьего молока и имеют мягкий сливочный вкус. Смесь уникальна, так как большинство важнейших компонентов, в том числе и нуклеотиды, содержатся в цельном козьем молоке естественным образом и сохраняются в процессе производства.

• Экологическая чистота

Новая Зеландия — одна из самых экологически чистых стран в мире. Козочки, на основе молока которых созданы смеси НЭННИ, в течение всего года питаются свежей травой, в отличие от европейских коз, получающих зерновые комбикорма.

• Возможность кормления детей с непереносимостью белков коровьего молока и риском развития пищевой аллергии

Лечебный и профилактический эффект смесей НЭННИ обусловлен природными свойствами козьего молока, в котором практически отсутствует один из основных аллергенов коровьего молока α-s1-казеин. Эффективность смесей НЭННИ в профилактике и лечении пищевой аллергии клинически доказана.

ПИЩЕВАЯ ЦЕННОСТЬ:

Основные компоненты На 100мл смеси На 100г порошка

Белки, в том числе г 1,6 12,0

Белки молочной сыворотки % 20 20

Жиры, в том числе (%) г 3,6 26,5

Линолевая кислота (к-та) (ω6) г 0,51 3,8

Альфа-линоленовая к-та г 0,058 0,43

Арахидоновая к-та (ω6) мг 8,7 65

Докозагексаеновая к-та (ω3) мг 8,1 60

Эйкозапентаеновая к-та (ω3) мг 1,7 13

Линолевая к-та (ω6) / сумма жирных к-т % 16 16

Углеводы, в том числе г 7,4 55,3

Лактоза г 5,8 43,3

Лактоза (содержание в углеводах) % 78 78

Мальтодекстрин г 1,1 8,3

Пребиотический комплекс (инулин, олигофруктоза) г 0,50 3,7

Зола г 0,46 3,4

Минеральные вещества

Кальций мг 66 490

Фосфор мг 51 380

Калий мг 83 620

Натрий мг 28 210

Магний мг 6,7 50

Медь мкг 50 370

Марганец мкг 4,3 32

Железо мг 0,74 5,5

Цинк мг 0,6 4,5

Йод мкг 9,4 70

Селен мкг 2,1 16

Витамины

Ретинол (А) мкг 54 400

Токоферол (Е) мг 0,82 6,1

Кальциферол (D) мкг 0,91 6,8

Витамин К мкг 4,2 31

Тиамин (В1) мкг 66 490

Рибофлавин (В2) мкг 99 740

Пантотеновая кислота мг 0,34 2,5

Пиридоксин (В6) мкг 47 350

Ниацин (РР) мг 0,7 5,2

Фолиевая кислота (Вс) мкг 7,5 56

Цианокобаламин (В12) мкг 0,17 1,3

Аскорбиновая к-та (С) мг 9,7 72

Биотин мкг 2,4 18

Таурин мг 4,6 34

Инозит мг 5,9 44

Холин мг 10 75

L-карнитин мг 1,2 9,2

Нуклеотиды мг 1,4 10

Осмоляльность мОсм/кг 310 310

Энергетическая ценность ккал 67 500

БЗМЖ Смесь Нэнни 2 с пребиотиками на козьем молоке …

Изготовитель:

Dairy Goat Co-operative (N.Z.) Ltd, Новая Зеландия

Описание товара:

Cухая адаптированная последующая молочная смесь на основе козьего молока «НЭННИ 2 с пребиотиками» 800 г.

Состав товара:

Молоко цельное козье сухое*, лактоза, смесь растительных масел (подсолнечное, каноловое, кокосовое, высокоолеиновое подсолнечное, антиокислители [подсолнечный лецитин, концентрат смеси токоферолов]), мальтодекстрин, пребиотический комплекс Orafti® Synergy 1 (инулин, олигофруктоза), инкапсулированный жир морских рыб (докозагексаеновая кислота, эйкозапентаеновая кислота), минеральные вещества (натрий, кальций, железо, цинк, медь, йод, марганец, селен), инкапсулированное масло Mortierella alpina (источник арахидоновой кислоты), витамины (С, холин, Е, PP, D, А, пантотеновая кислота, В1, L-карнитин, В12, К, В6, В2, фолиевая кислота, биотин), регулятор кислотности (лимонная кислота), триптофан, таурин. *100% новозеландское происхождение.

Способ приготовления:

Используйте только приложенную мерную ложечку. Добавляйте строго по 1 мерной ложечке (4,5 г) сухой смеси на каждые 30 мл воды в бутылочке. Готовьте смесь непосредственно перед кормлением. Никогда не храните смесь, оставшуюся в бутылочке после кормления. При необходимости приготовления смеси заранее бутылочку со смесью охладите под струей холодной воды и храните в холодильнике при температуре 4°C не более 12 часов. Не подогревайте смесь в микроволновой печи. Не используйте для приготовления смеси повторно вскипяченную воду. Не добавляйте в смесь сахар или хлопья. До и после вскрытия банки храните продукт при температуре от +10 °С до +25 °С и влажности не более 50 %. Не храните банку в холодильнике. Не подвергайте банку воздействию прямых солнечных лучей и высоких температур. После вскрытия банку плотно закрывайте пластиковой крышкой и используйте в течение не более 4-х недель.

Меры предосторожности:

До и после вскрытия храните банку при влажности не более 50%. Не храните банку в холодильнике. Не подвергайте банку воздействию прямых солнечных лучей и высоких температур. После вскрытия банку плотно закрывайте пластиковой крышкой и используйте в течение не более 4 недель.

Пребиотики, пробиотики и ваше здоровье

Пребиотики, пробиотики и ваше здоровье

Узнайте о разнице между пробиотиком и пребиотиком и о том, зачем они вам нужны.

Персонал клиники Майо

Ты то, что ты ешь. Или, точнее, вы — это то, чем вы кормите триллионы маленьких тварей, живущих в вашем кишечнике.

Слизистая оболочка вашего кишечника, как и любая поверхность вашего тела, покрыта микроскопическими существами, в основном бактериями.Эти организмы создают микроэкосистему, называемую микробиомом. И хотя мы на самом деле не замечаем его присутствия, он играет огромную роль в вашем здоровье и может даже влиять на ваше настроение и поведение.

Неудивительно, что то, чем вы кормите свой микробиом, может оказать наибольшее влияние на его здоровье. И чем он здоровее, тем здоровее вы. Ключом к здоровому микробиому является поддержание баланса между почти 1000 различных видов бактерий в кишечнике.

Есть два способа поддерживать этот баланс: помочь уже существующим микробам расти, давая им пищу, которая им нравится (пребиотик), и добавить живые микробы непосредственно в организм (пробиотик).

Пребиотики

Пребиотики — это специализированные растительные волокна. Они действуют как удобрения, которые стимулируют рост здоровых бактерий в кишечнике.

Пребиотики содержатся во многих фруктах и ​​овощах, особенно в тех, которые содержат сложные углеводы, такие как клетчатка и резистентный крахмал. Эти углеводы не усваиваются вашим организмом, поэтому они проходят через пищеварительную систему, чтобы стать пищей для бактерий и других микробов.

Список пребиотических продуктов длинный, от спаржи до ямса.Быстрый поиск в Интернете даст десятки примеров, как и консультация с зарегистрированным диетологом.

В настоящее время список пребиотических добавок может быть еще длиннее, но они обычно содержат сложные углеводы, такие как клетчатка. Компании-производители добавок продают продукты для определенных условий, таких как здоровье костей и контроль веса, утверждая, что их ингредиенты усиливают рост определенных видов бактерий.

Пробиотики

Пробиотики отличаются тем, что они содержат живые организмы, обычно определенные штаммы бактерий, которые напрямую увеличивают популяцию здоровых микробов в кишечнике.

Как и пребиотики, пробиотики можно принимать как с пищей, так и с добавками. Вероятно, самый распространенный продукт с пробиотиками — это йогурт.

Йогурт производится путем ферментации молока различными бактериями, которые остаются в конечном продукте. Другие ферментированные бактериями продукты, такие как квашеная капуста, чайный гриб и кимчи, также являются хорошими источниками пробиотиков.

Пробиотические добавки

также содержат живые организмы. Разовая доза может включать определенный штамм микроба или смесь микробов.Как и в случае с пребиотическими добавками, компании-производители пробиотических добавок продают продукты для определенных состояний, таких как синдром раздраженного кишечника.

Зарегистрированный диетолог может помочь вам разобраться в пищевых источниках пребиотиков и пробиотиков.

Имейте в виду

Одна вещь, которую нужно понимать о добавках, это то, что их существует очень много видов. Например, одним из обычно используемых типов бактерий является молочнокислая бактерия. Но существует более 120 видов лактобактерий, и не менее десятка из них используются в качестве пробиотиков.

Более того, существует несколько других типов бактерий, каждый из которых имеет десятки видов, что создает головокружительное разнообразие доступных пробиотиков. И даже когда вы выбираете тип бактерий, количество в добавке может варьироваться в зависимости от бренда.

Принимая пробиотик, изучите состояние, которое вы хотите лечить, и выберите пробиотик в зависимости от этого состояния. Кроме того, имейте в виду, что, хотя пробиотик может быть многообещающим в лечении состояния, вполне вероятно, что исследования все еще находятся на ранних стадиях.

Хотя добавка могла улучшить состояние некоторых людей в очень ограниченных обстоятельствах, в реальных условиях она может работать не так хорошо. Как всегда, при рассмотрении вопроса о приеме добавки сначала поговорите со своим врачом.

Получите самую свежую медицинскую информацию от экспертов Mayo Clinic.

Зарегистрируйтесь бесплатно и будьте в курсе последних научных достижений, советов по здоровью и актуальных тем, связанных со здоровьем, таких как COVID-19, а также экспертных знаний по управлению здоровьем.

Узнайте больше об использовании данных Mayo Clinic.

Чтобы предоставить вам наиболее актуальную и полезную информацию, а также понять, какие информация полезна, мы можем объединить вашу электронную почту и информацию об использовании веб-сайта с другая информация о вас, которой мы располагаем. Если вы пациент клиники Майо, это может включать защищенную информацию о здоровье.Если мы объединим эту информацию с вашей защищенной медицинской информации, мы будем рассматривать всю эту информацию как информацию и будет использовать или раскрывать эту информацию только так, как указано в нашем уведомлении о практики конфиденциальности. Вы можете отказаться от получения сообщений по электронной почте в любое время, нажав на ссылка для отписки в письме.

Подписаться!

Спасибо за подписку

Наш электронный информационный бюллетень Housecall будет держать вас в курсе последней медицинской информации.

Извините, что-то пошло не так с вашей подпиской

Повторите попытку через пару минут

Повторить попытку

27 февраля 2021 г. Показать ссылки
  1. Lyte M, et al.Резистентный крахмал изменяет ось микробиота-кишечник мозга: последствия для диетической модуляции поведения. ПЛОС Один. 2016;11:1.
  2. Куигли Э.М. Основные определения и понятия: Организация кишечного микробиома. Гастроэнтерологические клиники Северной Америки. 2017;9:2.
  3. Салонен А. и др. Влияние диеты и индивидуальных особенностей на состав микробиоты кишечника и продукты брожения у мужчин с ожирением. Журнал ИСМЕ. 2014;8:2218.
  4. Яцуненко Т. и соавт. Микробиом кишечника человека в зависимости от возраста и географии.Природа. 2012; 486:222.
  5. Раунтри Р. Микробиом человека. Люди как сверхорганизмы. Альтернативные и дополнительные методы лечения. 2011;17:70.
  6. Линч С.В. и др. Ориентация на кишечную флору для лечения и профилактики заболеваний. Журнал семейной практики. 2016;65:2369.

.

Новый продукт на основе смеси пребиотиков предотвращает синдром раздраженного кишечника у мышей за счет улучшения микробиоты кишечника и модулирования иммунного ответа

Abstract

Синдром раздраженного кишечника (СРК) является наиболее распространенным функциональным желудочно-кишечным расстройством, но для его профилактики до сих пор не существует эффективных методов профилактики.Целью данного исследования является определение того, может ли новая смесь пребиотиков (ПБ), состоящая из фруктоолигосахаридов (ФОС), галактоолигосахаридов (ГОС), инулина и антоцианов, быть эффективной для предотвращения развития СРК. Мы исследовали возможные механизмы как у животных, так и у клеток. Были созданы постинфекционные модели СРК у мышей C57BL/6, которых предварительно обрабатывали PB, PB и пробиотическими штаммами за 8 недель до инфицирования. Через восемь недель после заражения ткани кишечника собирали для оценки гистоморфологии, висцеральной чувствительности, барьерной функции, экспрессии провоспалительных цитокинов и протеомного анализа.Образцы фекалий также были собраны для анализа микробиоты. Экспрессию провоспалительных цитокинов в клетках Caco-2 оценивали после совместной инкубации с PB и Salmonella typhimurium 14028. Результаты показали, что PB значительно снижал провоспалительные цитокины как в инфицированных клетках Caco-2, так и в моделях PI-IBS. . Потеря массы тела, снижение экспрессии белка плотных контактов окклюдина (OCLN) и изменения состава микробиоты, вызванные инфекциями, могут быть значительно улучшены с помощью вмешательства ПБ ( p < 0.05). Протеомный анализ показал, что эта функция связана с γ-путем рецептора, активируемого пролифератором пероксисом (PPAR).

Ключевые слова: пребиотики, синдром раздраженного кишечника, воспаление, висцеральная гиперчувствительность, микробиота кишечника, смесь пребиотиков (СБ)

1. Введение

чувствительность и измененная функция центральной нервной системы без органических заболеваний.Синдром раздраженного кишечника (СРК) является наиболее распространенным типом функционального расстройства, характеризующимся болью и дискомфортом в животе и связанным с нарушением функции кишечника [1,2]. На основании симптомов СРК может характеризоваться преобладанием запоров (СРК-З) или диареи (СРК-Д) или смешанного стула (СРК-М), а также СРК без подтипа (СРК-Н) [2,3]. . Глобальная распространенность СРК составляет 11,2%, при этом уровень заболеваемости превышает 20% в Англии, Америке, Греции и Пакистане и 10-15% в Китае, Канаде и Австралии [4,5].Высокая распространенность вместе со сниженным качеством жизни больных СРК ложится значительным негативным бременем как на пациентов, так и на общество. Мета-анализ продемонстрировал шести-семикратное увеличение риска развития СРК после эпизода гастроэнтерита, что делает желудочно-кишечные инфекции, вероятно, самым сильным известным фактором риска развития СРК [6]. Такие случаи определяются как постинфекционный СРК (PI-IBS). Поскольку острый инфекционный гастроэнтерит (ИГЭ) поражает миллионы людей в год, особенно путешественников в развивающиеся страны, PI-IBS представляет собой потенциально большое бремя болезни [7].В последние десятилетия различные психологические профили и заболевания известны как факторы риска стойких постинфекционных симптомов: как депрессия, так и тревога считаются факторами риска [8]. У пациентов с PI-IBS наблюдаются некоторые сходные симптомы с пациентами неинфекционного происхождения [9].

СРК также считается «мозгово-кишечным расстройством» [10]. Боль в животе, висцеральная гиперчувствительность, нарушение перистальтики кишечника и повышенная проницаемость кишечной стенки — все это вовлечено в патофизиологию СРК [11].Предварительные исследования показали, что изменения иммунной активации слизистой оболочки и дисбактериоз микробиоты кишечника могут способствовать развитию СРК. Действительно, роль кишечной микробиоты рассматривалась как ключевой фактор, влияющий на «связь между мозгом и кишечником». Было подтверждено, что микробиота кишечника играет различные роли в поддержании здоровья хозяина, например, в метаболизме лекарств, производстве необходимых витаминов и предотвращении колонизации патогенов [12]. Растущее число исследований демонстрирует, что разнообразие, стабильность и метаболическая активность микробиоты кишечника изменяются у большинства пациентов с СРК по сравнению со здоровыми людьми [13,14,15].Следует отметить, что нарушенная микробиота является одним из важнейших патологических факторов PI-IBS. Заметный сдвиг в микробиоте после острого гастроэнтерита может быть причиной длительных симптомов PI-IBS [16].

Из-за неоднородности СРК трудно разработать значимые схемы лечения для всех пациентов. Используются различные методы лечения, такие как масло перечной мяты, лубипростон, линаклотид, антибиотики, диетическое вмешательство и растворимая клетчатка [10].Однако все эти методы лечения кажутся симптоматическими. Поскольку была выявлена ​​важность кишечной микробиоты в патогенезе СРК, манипулирование микробиотой становится привлекательным терапевтическим вариантом для этого заболевания [17]. Вмешательства пробиотиков, пребиотиков, синбиотиков и антибиотиков являются примерами таких стратегий, используемых для модуляции микробиоты кишечника у пациентов с СРК [18,19,20,21,22,23,24,25,26,27,28]. Было доказано, что большинство этих испытаний эффективны в облегчении симптомов СРК.Пребиотики, определяемые как «неперевариваемые пищевые ингредиенты, которые благотворно влияют на хозяина, избирательно стимулируя рост и/или активность одного или ограниченного числа видов бактерий, уже обитающих в толстой кишке, и, таким образом, пытаются улучшить здоровье хозяина». называют «функциональным питанием». Эти пребиотики избегают всасывания в тонком кишечнике и попадают в толстый кишечник, где они обеспечивают питательными веществами полезные бактерии [29]. Это определение концепции было дополнительно расширено как «субстрат, который избирательно используется микроорганизмами-хозяевами, принося пользу для здоровья» [30].Некоторые пребиотики относятся к группе неперевариваемых углеводов: моносахариды, дисахариды, олигосахариды, полиолы и так далее. Однако эти терапевтические подходы используются только для облегчения симптомов у пациентов с СРК, а не для лечения заболевания. Существует несколько исследований, в которых изучается влияние пребиотиков на модулирование микробиоты кишечника для предотвращения развития СРК. Это исследование представляет собой исследование нового пребиотического продукта под названием «PB», состоящего из фруктоолигосахаридов (ФОС), галактоолигосахаридов (ГОС), инулина и антоцианов в этом контексте.Мы разработали это исследование, чтобы проверить, могут ли ФБ или симбиотики, содержащие ФБ и определенные пробиотические штаммы, быть эффективными в профилактике СРК. Кроме того, мы исследовали возможный механизм такого лечения на постинфекционной мышиной модели и на линии эпителиальных клеток толстой кишки.

2. Материалы и методы

2.1. Культуры бактерий

S. typhimurium 14028 выращивали в свежей среде бульона Луриа в течение ночи при температуре 37 °C, пока они не достигли поздней экспоненциальной фазы.Суспензию культуры бактерий разводили и определяли оптическую плотность. Пробиотические штаммы, используемые в этом исследовании, включают Lactobacillus acidophilus NCFM и Bifidobacterium lactis HN019 в форме лиофилизированного порошка (Pharmanex ® ProBio, лот DP22451, поставляемый Центром антивозрастных исследований, Nu Skin Enterprises, Шанхай, Китай).

2.2. Продукт, содержащий пребиотик

PB (поставляемый Центром антивозрастных исследований, Nu Skin Enterprises, Шанхай, Китай) состоял из GOS плюс FOS, инулина и антоцианов в форме лиофилизированного порошка.Порошок суспендировали в физиологическом растворе перед обработкой.

2.3. Обработка клеток Caco-2

Клетки Caco-2 выращивали в чашках Петри диаметром 55 см 2 (CORNING) со средой DMEM (Gibco, Карлсбад, Калифорния, США) с добавлением 2 мМ l-глютамина (Gibco), 0,2 мМ 15 % эмбриональной телячьей сыворотки (Gibco) и 100 ЕД/мл стрептомицина и пенициллина (Gibco), поддерживаемых при 37 °C в инкубаторе с 5% CO 2 (Thermo Scientific, Уолтем, Массачусетс, США). Затем клетки высевали на 6-луночные планшеты (COSTAR) плотностью 2.2 × 10 6 клеток на лунку до достижения 80–100% слияния. Голодные клетки Caco-2 инкубировали в течение 12 часов в среде для культивирования клеток без добавления FBS. S. typhimurium добавляли в среду для культивирования клеток и инокулировали в клетки Caco-2 в 6-луночных планшетах при множественности заражения (MOI) 10:1. ФБ добавляли в питательные среды в дозе 1 мг/мл. После стимуляции в течение 0,5 ч, 1 ч и 2 ч супернатанты собирали для обнаружения с помощью твердофазного иммуноферментного анализа (ELISA).Суммарная РНК клеток экстрагируется. Рабочий процесс эксперимента с клетками Caco-2 показан на а; все опыты были повторены трижды.

Схематическая диаграмма ( a ) эксперимента с клетками Caco-2 и ( b ) модельного эксперимента на мышах.

2.4. Лечение животных и экспериментальные диеты

Четырехнедельные самки мышей C57BL/6 без специфических патогенов (SPF), использованные в этом исследовании, были получены из Лабораторного центра животных Шанхайского медицинского факультета Университета Цзяо Тонг (Шанхай, Китай) и содержались в ламинарный бокс в помещении для экспериментальных животных.Экспериментальная процедура была одобрена комитетом по защите животных Шанхайского медицинского факультета университета Цзяо Тонг. Перед испытанием 60 мышей были случайным образом разделены на 4 экспериментальные группы (по 15 мышей в группе в 3 клетках), из которых 3 группы получали через зонд физиологический раствор (группа MOCK), ФБ (1,26 мг/г массы тела, группа ФБ) , ФБ и пробиотики (1,26 мг/г массы тела ФБ плюс 3,0 × 10 7 КОЕ/мышь как Lactobacillus acidophilus NCFM, так и Bifidobacterium lactis HN019, группа PB/ProBio), соответственно.Обработку проводили каждый день, пока они не были умерщвлены. Последняя группа была определена как контрольная. Эта процедура показана на б. Всех животных содержали в цикле 12 светлых, 12 темных. Вес тела измеряли еженедельно. Образцы стула собирали как в начале исследования, так и через 8 недель после инфицирования. Тотальную ДНК экстрагировали из стула с помощью QIAamp ® Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany).

2.5. Инфекция Trichinella Spiralis

После 8-недельного лечения мышей в первых 3 группах заразили личинками Trichinella Spiralis .Инфекционных личинок получали из мышц мышей линии C57BL/6, инфицированных за 30 дней. Инфицированных мышей гуманным образом умерщвляли, снимали кожу, а мышцы, содержащие инцистированные личинки, измельчали ​​и переваривали в 2,5% пепсине А и 1,5% HCl при 37 °C в течение 20 часов. Выделенные инфекционные личинки несколько раз промывали, фильтровали через фильтр 70 мкм и ресуспендировали в физиологическом растворе. Мышей опытных групп заражали пероральным введением 350–400 личинок в 0,2 мл физиологического раствора, а мышам контрольной группы вводили такой же объем носителя.

2.6. Оценка абдоминального рефлекса отмены (AWR)

Висцеральную гипералгезию до колоректального вздутия (CRD) оценивали на 8-й неделе после заражения (PI) по шкале AWR. Катетер (6-Fr, внешний диаметр 2 мм) вводили ректально в нисходящую кишку мышей. После адаптации в течение 0,5 ч выполняли ступенчато колоректальное растяжение. После каждого 20-секундного вздутия следует 30-секундный период покоя. Каждый уровень набухания (0,15, 0,2, 0,3 и 0,35 мл) повторяли три раза, и оценка представляла собой среднее значение.Баллон сдули и извлекли после оценки AWR. Оценка AWR была присвоена следующим образом: 0 — отсутствие поведенческой реакции на колоректальное растяжение; 1 — кратковременное движение головы с последующей неподвижностью; 2 — сокращение мышц живота; 3, подъем живота; 4, выгибание тела и подъем тазовых структур [31,32].

2.7. Сбор и обработка образцов

Всех мышей из каждой группы гуманно умерщвляли (эфирная анестезия и смещение шейки матки) через 8 недель после заражения. Образцы кишечника, взятые из подвздошной кишки (30 см дистальнее привратника) и толстой кишки (дистальнее слепой кишки), промывали физиологическим раствором для удаления содержимого кишечника.Образец длиной 1 см из каждой ткани кишечника фиксировали в течение ночи в 4% параформальдегиде и заливали в парафин для гистологического анализа. Два кусочка ткани кишечника длиной 1,5 см немедленно консервировали в жидком азоте и хранили в криогенном холодильнике для последующего выделения РНК и анализа белков соответственно.

2.8. Гистологический анализ

Ткани подвздошной кишки, фиксированные в параформальдегиде, заливали в парафин и нарезали на срезы толщиной 5 мкм. Для депарафинизации срезы погружали в ксилол при 56°С дважды на 20 мин и гидратировали этанолом (дважды 100%, один раз 95% и один раз 75% этанолом) в течение 5 мин.Ткани обычно обрабатывали для гистологического исследования гематоксилина и эозина (H&E).

2.9. Иммуногистохимия (IHC) Обнаружение

Антитела против окклюдина (OCLN) (разведение 1:1000; Abcam, Кембридж, Великобритания) использовали для IHC. Срезы сухой ткани толщиной 6 мкм при 60 ° C в течение 20 мин. Предметные стекла подвергали депарафинизации и гидратации с последовательными промывками диметилбензолом в течение 20 минут, промывками 100% этанолом в течение 10 минут, затем последовательными промывками этанолом в течение 5 минут, которые начинались с 95% этанола, затем 80% и заканчивались 75% этанолом.Промойте слайды фосфатно-солевым буфером (PBS) дважды. Антиген извлекали путем нагревания водяной бани с буфером лимонной кислоты при 95 °C в течение 20 минут, а затем восстанавливали при комнатной температуре. Блокировать эндогенную пероксидазу путем инкубации 20 минут в 3% H 2 O 2 и мыть слайды с PBS. Блокируйте неспецифические сайты связывания с 5% БСА в течение 20 мин. Срезы исследовали кроличьими моноклональными антителами против окклюдина (разведение 1:1000; Abcam) при 4°С в течение ночи. После промывания предметных стекол PBS ткани исследовали биотинилированными вторичными антителами в течение 20 минут и выявляли результирующую пероксидазную активность путем инкубации предметных стекол с диаминобензидином (DAB) в течение 7 минут.Докрашивают гематоксилином в течение 1 мин. Обезвоживают слайды последовательными 5-минутными промывками этанолом, каждая из которых начинается с 75%, затем 80%, 95% и 100% промывки этанолом, заканчивая промывкой диметилбензолом.

2.10. Анализ количественной полимеразной цепной реакции в реальном времени (qRT-PCR)

Тотальную РНК клеток Caco-2, ткани толстой кишки каждой мыши экстрагировали с использованием раствора тризола. кДНК синтезировали с помощью набора для синтеза кДНК RevertAid First Strand (Thermo Scientific). В режиме реального количественная реакция ПЦР с использованием системы быстрой ПЦР в реальном времени 7500 (ABI, Уолтем, Массачусетс, США), GAPDH (глицеральдегид-3-фосфатдегидрогеназа) была настроена в качестве внутреннего стандарта.Каждую реакцию КПЦР проводили в двух повторностях, а уровень экспрессии определяли как среднее значение. Последовательности праймеров перечислены в .

Таблица 1

Последовательности праймеров для количественной полимеразной цепной реакции в реальном времени (qRT-PCR), используемые в этой статье.

TGCTAGGAGCCAGAGCAGTA ФНО-α (мышь)
Гены Последствия (5′-3 ‘) Gene

Forward AGTGTGACGTTGACATCCGT 11461
Revource
Форвард GAGGCCAAGCCCTGGTATG 21926
Обратный CGGGCCGATTGATCTCAGC
PPAR-γ (мышь) Форвард GGAAGACCACTCGCATTCCTT 19016
Обратный GTAATCAGCAACCATTGGGTCA
GAPDH (человеческий) Форвард ATGGGGAAGGTGAAGGTCG 2597
Reverse GGGTCATTGATGGCAACAATATC
IL-1B (человек) Форвард GAAATGCCACCTTTTGACAGTG 3553 90 206
Обратный TGGATGCTCATCAGGACAT
ИЛ-8 (человек) Форвард GACCACACTGCGCCAACAC 3576
Обратный CTTCTCCACAACCCTCTGCAC
ФНО-α (человек) Вперед GAGGCCAAGCCCTGGTATG 7124
Назад CGGGCCGATTGATCTCAGC

11. Вестерн-блот-анализ

RIPA (радиоиммунопреципитация) буфер для лизиса и экстракции (Beyotime, Шанхай, Китай), 0,1~1 мМ PMSF (Beyotime) использовали для экстракции белка из тканей кишечника и лизиса клеток. Концентрацию белка определяли с помощью набора для анализа белка Pierce™ BCA Protein Assay Kit (Thermo Scientific). Белки разделяли с помощью электрофореза в полиакриламидном геле с 10% додецилсульфатом натрия (SDS-PAGE), а затем переносили на нитроцеллюлозную мембрану для блоттинга (GE Healthcare, Чикаго, Иллинойс, США), которую блокировали 5% обезжиренным молоком.Мембрану инкубировали с первичными антителами к β-актину и целевому белку при 4°С в течение ночи. Затем добавляли вторичные антитела и инкубировали при комнатной температуре в течение 1 часа. После воздействия хемилюминесцентным субстратом SuperSignal West Pico (Thermo Scientific) полосы белка были показаны и выделены с помощью LAS-4000 MINI.

2.12. Анализ фекальной микробиоты

Общая ДНК была извлечена из образцов фекалий. Высокопроизводительное секвенирование 16S рДНК было выполнено Институтом геномики Realbio (Шанхай, Китай) с использованием Illumina HiSeq PE250.Вариабельные области V3–V4 генов 16S рДНК бактерий амплифицировали с прямым праймером F341 5′-ACTCCTACGGGRSGCAGCAG-3′ и обратным праймером R806 5′-GGACTACVVGGGTATCTAATC-3′. Необработанные парные концевые чтения были собраны с помощью пандасека с перекрывающимися нуклеотидами. Затем чтения были отфильтрованы по качеству. Затем необработанные данные подвергались процедуре контроля качества с использованием UPARSE. Квалифицированные чтения были сгруппированы для создания операционных таксономических единиц (OTU) на уровне сходства 97% с использованием Usearch. Анализ основных компонентов (PCA), анализ тепловой карты, кластер сходства Брея-Кертиса и анализ численности видов были выполнены с использованием R.

2.13. Протеомный анализ

Препараты 100 мкг белка из толстой кишки готовили в трех повторностях для каждой группы. Для каждого образца белки осаждали ледяным ацетоном, а затем повторно растворяли в 100 мкл ТЭАБ (бромид тетраэтиламмония). Затем белки расщепляли трипсином с модифицированным трипсином 1:50 (Promega, Мэдисон, Висконсин, США) и полученную смесь пептидов метили iTRAQ (изобарические метки для относительного и абсолютного количественного определения). Пептидную смесь разделяли при высоком рН, собирали двенадцать фракций и каждую фракцию сушили в вакуумном концентраторе для следующей стадии.Затем был проведен анализ нано-ВЭЖХ (высокоэффективная жидкостная хроматография)-МС (масс-спектр)/МС при низком рН. Скаффолд (версия Scaffold_4.7.5, Proteome Software Inc., Портленд, штат Орегон, США) использовали для проверки идентификации пептидов и белков на основе MS/MS. Скаффолд Q+ (версия Scaffold_4.7.5, Proteome Software Inc.) использовали для количественного определения пептидов и белков.

2.14. Статистический анализ

Значимость различий в баллах AWR между 3 группами PI-IBS и контрольной группой изначально определяли с помощью обычного двустороннего дисперсионного анализа и теста Тьюки.Значимость различий в количестве цитокинов между экспериментальными группами первоначально определяли с помощью однофакторного дисперсионного анализа. Множественные сравнения были выполнены с использованием апостериорного критерия Шеффе. Анализ значимости родов бактерий среди 4 групп был обнаружен с помощью критерия Манна-Уитни с корректировкой множественных тестов Бенджамини и Хохберга и поправкой Бонферрони. Результаты считались статистически значимыми при * p < 0,05, ** p < 0,01, *** p < 0.001, **** р < 0,0001.

3. Результаты

3.1. Профили провоспалительных цитокинов в клетках Caco-2 и животных моделях

Уровни мРНК цитокинов в клетках Caco-2, измеренные с помощью qRT-PCR, выявили резкое увеличение IL-1β , IL-8 и TNF- α после заражения S. typhimurium в течение 2 часов. Было показано, что уровни этих цитокинов значительно снижаются в клетках Caco-2, инкубированных с PB. Точно так же экспрессия мРНК этих провоспалительных цитокинов не показала значительной активации после обработки клеток Caco-2 ФБ.В тканях толстой кишки уровень мРНК TNF-α был заметно повышен в группах, инфицированных Trichinella Spiralis , но значительно снизился как в группах, получавших PB, так и в группах PB/ProBio. Обнаружение уровня белка вестерн-блоттингом показало ту же тенденцию (1). Но уровень экспрессии IL-10 почти не изменился среди 4 групп.

Профили экспрессии мРНК провоспалительных цитокинов в клетках Caco-2 после относительной обработки в течение 2 часов. Все данные представлены как среднее значение ± SEM.* р < 0,05, *** р < 0,001, **** р < 0,0001. § Отличается от 2h-PB, § p < 0,05, §§§§ p < 0,0001.

Влияние смеси пребиотиков (PB) и пробиотиков на модулирование экспрессии Tnf-a в тканях толстой кишки. Относительная мРНК каждой группы была показана средним значением ± SEM, n = 8 для каждой группы. ( a ) Относительная мРНК Tnf-α в 4 группах. **** р < 0.0001. ( b ) Верхняя панель: относительная интенсивность экспрессии белка TNF-α, рассчитанная как отношение TNF-α к β-актину. * р < 0,05, ** р < 0,01. Нижняя панель: Вестерн-блот анализ TNF-α в контрольных группах MOCK, PB, PB/ProBio и Health.

3.2. Симптомы у PI-IBS Model

На 2-й неделе после заражения масса тела мышей в инфицированных группах резко снижалась и медленно восстанавливалась в течение следующей недели (d). Кроме того, ткани кишечника были сильно повреждены на 1-й неделе после заражения и восстановились после периода острой инфекции (рис. S1).Никаких существенных различий в баллах AWR между 4 группами до инфицирования выявлено не было. Эти показатели были значительно выше в 3 инфицированных группах при объемах растяжения 0,20 и/или 0,30 мл. На 8-й неделе после заражения оценка AWR может быть снижена при лечении PB или PB/ProBio, что указывает на то, что висцеральная гиперчувствительность ниже в этих двух группах, но не восстанавливается полностью, как в нормальном состоянии (a–c).

Изменение массы тела и показателей абдоминального рефлекса втягивания (AWR) в 4 группах.Оценки AWR при различных уровнях растяжения в ( a ) за одну неделю до заражения, ( b ) через 2 недели после заражения и ( c ) через 8 недель после заражения. n = 15 в каждой группе. ( d ) Изменение массы тела. * р < 0,05, ** р < 0,01, *** р < 0,001, **** р < 0,0001.

3.3. Белок плотных контактов у мышей с PI-IBS

Экспрессию белка плотных контактов OCLN исследовали с помощью вестерн-блоттинга.Результат показал, что экспрессия OCLN в группе MOCK была ослаблена по сравнению с таковой в контрольной группе. Повышенная экспрессия OCLN наблюдалась как в группах PB, так и в группах PB/ProBio (а). IHC-анализ OCLN выявил аналогичную тенденцию (б).

Экспрессия белка окклюдина (OCLN) в разных группах. ( a ) Иммуногистохимический анализ OCLN в толстой кишке. ( b ) Верхняя панель: относительная интенсивность экспрессии белка OCLN, рассчитанная как отношение OCLN кβ-актин. Нижняя панель: Вестерн-блот анализ OCLN в контрольных группах MOCK, PB, PB/ProBio и Health. * р < 0,05, ** р < 0,01, *** р < 0,001.

3.4. Экспрессия PPARγ

Протеомный анализ выявил 5403 белка в каждой группе. При сравнении этих белков между группой MOCK и другими тремя группами большинство этих белков были разными. Небольшая часть этих различных белков, которая увеличилась или уменьшилась более чем на 1.На тепловой карте показаны 2 складки (рис. S2). Было обнаружено, что передача сигналов PPARγ значительно изменилась ( p <0,05) при сравнении группы MOCK с группой PB с использованием анализа пути KEGG. Экспрессия PPARγ в тканях толстой кишки была подтверждена с помощью вестерн-блоттинга, который показал, что экспрессия PPARγ снизилась в группе MOCK по сравнению с контрольной группой, но значительно увеличилась в группе PB и группе PB/ProBio по уровням белка ().

Уровень экспрессии PPARγ в 4 группах.Все данные были представлены как среднее ± SEM. ( n = 3). Верхняя панель: относительная интенсивность экспрессии белка PPARγ, рассчитанная как отношение PPARγ к β-актину. Нижняя панель: Вестерн-блот анализ PPARγ в контрольных группах MOCK, PB, PB/ProBio и Health. * р < 0,05, ** р < 0,01.

3.5. Альтернирование микробиоты

PCA и кластерный анализ сходства Брея-Кертиса вместе с кластером тепловой карты, основанным на обилии OTU, были выполнены, чтобы предоставить обзор состава микробиоты кишечника трех групп PI-IBS и контрольной группы здоровья (a–c) .Достоверных различий в α-разнообразии микробиоты между всеми группами выявлено не было (г). Общая характеристика состава микробиоты в группе MOCK значительно отличалась от таковой в контрольной группе. Между тем, присутствие PB или PB/ProBio улучшило это изменение. После поправки Бонферрони в анализе микробиоты только несколько родов, как правило, имеют значительные различия между разными группами. Линейный дискриминантный анализ (LDA) показал, что численность бактерий родов Vampirovibrio и Akkermansia уменьшилась в группе MOCK, а в группах PB/ProBio увеличилась.Относительный изобилие recea Closttridium XIVA, CLADTRIDIM_SENSU_STRICTO , prevotella , ochrobactrum , ochrobactrum , GEMMIGER , , GEMMIGER , MUCISPIRILLUM , MUCISPITILLUM Увеличено в PB группе или группе PB/ProBio по сравнению с группой MOCK. Обилие Генеральных Acinetobacter , Roseetoburia , метилобактерия , Parabacteroides , RikenellaS , Microbacterium , Microbacterium , EnterOrhabdus , Anaeroplasma , Roseburia , Clostridium IV, Clostridium XIVb, Desulfovibrio и Escherichia/Shigella значительно увеличились в группе MOCK по сравнению с контрольной группой.За исключением первых четырех родов бактерий, количество других родов бактерий относительно уменьшилось в группе MOCK по сравнению с группами PB и PB/ProBio (a–d).

Изменения микробиоты кишечника и альфа-разнообразие в разных группах. ( a ) График анализа основных компонентов (PCA), показывающий кластер сообществ микробиоты с различной обработкой. ( b ) График неметрического многомерного масштабирования (NMDS), основанный на расстояниях Брея-Кертиса фекальной микробиоты. Каждая точка данных представляет образец фекалий из этих групп с соответствующими метками, указанными справа.( c ) Тепловые карты и кластеризация отдельных образцов кишечной микробиоты для таксономического состава. ( d ) Разнообразие Шеннона.

Сравнение проекта фекального микробиома группы MOCK с другими группами. Все данные таксономической информации в четырех группах были проанализированы с помощью программы Metaphlan2, кладограмма ( a ) была получена из анализа LEfSe (http://huttenhower.org/galaxy/). Линейный дискриминантный анализ (LDA) фекальной микробиоты в группе MOCK и группе PB ( b ), группе MOCK и группе PB/ProBio ( c ), группе MOCK и Health control ( d ).Значение p <0,05 и оценка ≥2,0 считались значимыми в критериях Крускала-Уоллиса и парных критериях Уилкоксона соответственно. Горизонтальная прямая линия на панели указывает средние значения групп.

4. Обсуждение

Синдром раздраженного кишечника является одним из наиболее распространенных заболеваний нижних отделов желудочно-кишечного тракта, этиологические факторы которого очень сложны (). Симптомы СРК могут быть вызваны острыми или хроническими кишечными инфекциями и могут сохраняться в течение недель, месяцев и даже лет [33,34].На ПИ-СРК приходится 4–39% всех случаев СРК [35,36]. Таким образом, постинфекционная модель является применимой моделью для исследований СРК. В этом исследовании мы создали успешную модель мыши с PI-IBS. Через восемь недель после заражения мышей Trichinella Spiralis поврежденный слой кишечного эпителия и собственная пластинка уже восстановились (рис. S1). Тем не менее, висцеральная гиперчувствительность и слабовыраженное воспаление все еще существовали в сочетании со сниженным уровнем экспрессии белка плотных контактов кишечника.Эти явления согласуются с предыдущими исследованиями моделей СРК [31].

Факторы патогенеза, связанные с синдромом раздраженного кишечника (СРК), на которые могут влиять PB и PB/ProBio. Дисбиоз кишечной микробиоты значительно улучшился с помощью PB и PB/ProBio. Во многих экспериментальных моделях было показано, что пробиотики стимулируют регуляторные Т-клетки. Известно, что различные пребиотики и пробиотики снижают иммуноопосредованную активацию при СРК [70,81]. ФБ и ФБ/ПроБио оказывали противовоспалительное действие как in vitro, так и in vivo.Многие доступные пробиотики могут усиливать функцию кишечного барьера за счет усиления экспрессии белков плотных контактов, стимулирования секреции слизи и антимикробных пептидов клетки-хозяина, а также прямого высвобождения антимикробных факторов [82]. В этом исследовании показано, что PB и PB/ProBio увеличивают экспрессию белка плотных контактов. Энтеральные нейроны экспрессируют Toll-подобные рецепторы, проявляющие чувствительность к микробным метаболитам, и, таким образом, энтеральная нервная система (ЭНС) способна реагировать на микробы [83].SCFAs, метаболиты нормальной микробиоты, способны стимулировать высвобождение серотонина симпатической нервной системой и слизистой оболочкой. Микробиота может влиять на активность ЭНС, продуцируя молекулы, которые могут действовать как локальные нейротрансмиттеры, такие как ГАМК и гистамин, а также генерируя биологически активную форму катехоламинов в просвете кишечника [84]. Активация ENS отвечает за висцеральную гиперчувствительность, которую можно подавить с помощью PB и PB/ProBio. Сокращения: SCFA, жирная кислота с короткой цепью; ЭК, энтерохромаффинные клетки; IEC, кишечные эпителиальные клетки; TJP, белок плотных контактов; ГАМК, гамма-аминомасляная кислота; TLR, толл-подобный рецептор; GPCR, рецептор пары G-белков; ЭНС, энтеральная нервная система.

Лечение СРК доступными в настоящее время препаратами обычно направлено на облегчение отдельных симптомов, таких как запор, диарея и боль в животе [10]. Конкретные пробиотические штаммы и пребиотики, известные как фруктоолигосахариды, дисахариды, моносахариды и полиолы, доказали свою эффективность в лечении СРК с помощью различных механизмов () [37,38,39,40,41]. Тем не менее, профилактический эффект пребиотиков или пробиотиков при СРК малоизвестен. В нескольких исследованиях сообщалось о роли антоцианов в модуляции воспаления и окислительного стресса, и было показано, что они помогают снизить риск хронических заболеваний [42,43].По сравнению с живыми пробиотическими бактериями применение нашего пребиотического продукта более безопасно [44]. Целью настоящего исследования является изучение профилактической функции этого нового дополнительного соединения при СРК. Наши результаты показали, что клинические проявления модели PI-IBS могут быть значительно улучшены за счет предварительного вмешательства PB. В этом исследовании мыши потеряли массу тела после перорального введения личинок Trichinella Spiralis по сравнению с контрольной группой. Однако масса тела мышей, получавших ФБ и пробиотики, восстанавливалась быстрее.

Висцеральная гиперчувствительность является важным патологическим механизмом и физиологическим маркером у пациентов с СРК. Эта висцеральная гиперчувствительность может объяснять такие симптомы, как императивные позывы, вздутие живота и боль в животе у пациентов с СРК [45]. В нашем исследовании показатели AWR значительно увеличились в группах с PI-IBS в ответ на среднее давление на прямую кишку, но не отличались от показателей здоровых мышей при низком или высоком давлении. Когда объем расширения составлял 0,15 мл, давление на толстой кишке было слишком низким, чтобы вызвать разные висцеральные ощущения у всех мышей.Когда 0,35 мл газа вводили в прямую кишку, показатели AWR почти у всех мышей были на уровне 4 мл, что свидетельствует о том, что объем газа достиг порога висцеральной боли. Мыши в первых 3 группах PI-IBS показали значительно более высокие показатели AWR, что указывало на повышение висцеральной чувствительности у мышей после заражения. Однако после предварительной обработки PB и PB/ProBio у мышей не наблюдалось заметных различий с группой MOCK, в то время как обработка PB заметно снижала значимость различий по сравнению с MOCK и мышами.контроль состояния здоровья как через две, так и через восемь недель после заражения. Этот результат продемонстрировал, что успешно созданная модель PI-IBS может быть улучшена с помощью вмешательства PB.

В клиническом исследовании, включавшем 111 пациентов с СРК и 162 контрольных больных, комбинация генотипа «высокого продуцента» TNF и генотипа «низкого продуцента» IL-10 была более распространена у пациентов с СРК [46]. Кроме того, сообщалось о различных результатах для уровней цитокинов. В некоторых исследованиях уровни TNF и IL-6, секретируемые РВМС (мононуклеарными клетками периферической крови) у пациентов с СРК, хотя и находились в пределах нормы, были выше, чем уровни, секретируемые стимулированными РВМС контрольной группы в других исследованиях [47,48, 49].Чтобы определить, улучшает ли PB воспалительный статус у мышей с PI-IBS и стимулирует ли Salmonella клетки Caco-2, мы обнаружили экспрессию провоспалительных медиаторов как в тканях толстой кишки, так и в клетках Caco-2. В клетках Caco-2 активация TNF-A , IL-1B и IL-8 , индуцированная S. typhimurium , могла ингибироваться PB. Насколько нам известно, пребиотики служат «пищей толстой кишки» для кишечных бактерий [30]. Но они могут подавлять воспаление независимым от микробиоты способом, при котором эти компоненты могут стимулировать путь NF-κB (ядерный фактор каппа B) и напрямую регулировать кином хозяина [50,51].В модели на животных мы обнаружили, что уровни мРНК и белка TNF-α в группе MOCK значительно увеличились при почти неизменном уровне IL-10 (не показано), в то время как в группах профилактики PB или PB/ProBio они снизились. Результаты как in vitro, так и in vivo показали, что PB может ослаблять воспаление как в клетках Caco-2, так и в модели мышей IBS.

Наиболее очевидная особенность кишечного барьера состоит из одного слоя эпителиальных клеток слизистой оболочки, которые соединены между собой плотными контактами, которые обеспечивают прохождение небольших молекул [11].Сообщается, что от двенадцати до пятидесяти процентов пациентов с СРК имеют сниженную кишечную проницаемость [52]. Все большее число исследований поддерживает концепцию о том, что повышенная проницаемость кишечника связана с повышенной активностью иммунной системы и пищевой аллергией [53]. Было показано, что ферментируемая клетчатка сокращает время восстановления и улучшает плотные соединения в кишечнике поросят с энтеритом, вызванным бактериальной инфекцией [54]. Наш молекулярный анализ белков, связанных с плотными контактами, продемонстрировал снижение экспрессии OCLN у мышей с PI-IBS.Восьминедельное добавление ФБ резко изменило это изменение, что показало повышенную проницаемость кишечника, что указывает на роль ФБ в защите целостности эпителиального слоя кишечника.

Считается, что дисбиоз кишечной микробиоты играет решающую роль в развитии СРК. Новые данные свидетельствуют о том, что разнообразие, стабильность и метаболическая активность фекальной микробиоты изменены у большинства пациентов с СРК по сравнению с контрольной группой [13,14,15]. Согласно предыдущим исследованиям, кластер фекальной микробиоты в группе PI-IBS четко отличается от такового в контрольной группе.С терапевтической точки зрения при лечении СРК применялись определенные пробиотические штаммы, пребиотические продукты и даже антибиотики, такие как рифаксимин, которые могут способствовать модуляции микробиоты. В PB основными ингредиентами являются FOS, GOS, инулин и антоцианы, о каждом из которых сообщалось отдельно для модуляции кишечной микробиоты. Сообщалось, что инулины стимулируют рост или активность полезных бактерий и избирательно подавляют уровень вредных бактерий [55, 56]. Недавние исследования также показали, что антоцианы из ежевики могут изменять состав и разнообразие микробиоты [57].В группе предварительного лечения PB состав микробиоты был более похож на контроль здоровья, что позволяет предположить, что PB может помочь поддерживать гомеостаз кишечной флоры. На уровне рода мы обнаружили высокую долю (> 5%) Barnesiella во всех группах. Уровень рода Barnesiella значительно снизился в группе PI-IBS, в то время как это изменение было сильно обращено вспять в группе до лечения PB. Barnesiella , род семейства Porphyromonadaceae , порядка Bacteroidales , был одним из наиболее распространенных родов, обнаруженных в кишечнике мышей.В недавних исследованиях из кишечника человека и животных было выделено много новых последовательностей, которые можно идентифицировать как род Barnesiella . Тем не менее до сих пор остается неясным, как обилие Barnesiella связано с воспалительными заболеваниями желудочно-кишечного тракта [57]. Некоторые сообщения проливают свет на функцию Barnesiella, сообщая, что бактерии Barnesiella способствуют элиминации и защите от устойчивых к ванкомицину колоний Enterococcus faecium [58].Обилие Barnesiella коррелирует с уровнем нескольких иммунорегуляторных клеток. Чем выше уровни Barnesiella в толстой кишке, тем больше В-клеток маргинальной зоны и инвариантных естественных киллерных Т-клеток в селезенке и печени [58,59]. Прямая связь между изменением Barnesiella и устойчивостью к артриту была продемонстрирована на моделях мышей [60]. При развитии колита у мышей IL-10 -/- более высокие уровни филотипа Barnesiella коррелировали с более низкими уровнями активности заболевания [61].Такие наблюдения показывают, что род Barnesiella полезен для здоровья человека, защищая кишечный тракт от патогенных инфекций и играя роль в иммуномодуляции. Значительно более высокие уровни Barnesiella наблюдались после употребления PB/ProBio и свидетельствовали о противовоспалительных эффектах в профилактике СРК. Многие отчеты показали, что относительное изобилие Coliform BACTERIA, Veellonella , Prevotella , Parasorobacillus , Parasorobacterium , Parasorobacterium , Close , в основном Closttridium Кластер XIVA и RUMUMOCOCCACEAE . со снижением относительной численности Bacteroidetes [11].У человека комменсальные клостридии начинают колонизировать кишечник младенцев, находящихся на грудном вскармливании, в течение первого месяца жизни и заселяют определенный участок слизистой оболочки кишечника в тесной взаимосвязи с клетками кишечника. Таким образом, клостридии активно участвуют в поддержании общей функции кишечника [62]. Комменсальные клостридии играют важную роль в метаболическом благополучии колоноцитов, высвобождая бутират в качестве конечного продукта ферментации, который оказывает множество полезных эффектов на регулирование метаболизма млекопитающих [63,64,65,66].Несколько сообщений показали, что Clostridia, по-видимому, участвует в стимулировании иммунологического развития в толстой кишке [64]. Примечательно, что на экспериментальных моделях мышей было показано, что повышенные уровни кластеров Clostridium XIVa у мышей могут приводить к устойчивости к аллергии и воспалению кишечника [67]. В этом исследовании увеличение Clostridium XIVa и Clostridium sensu stricto в группе PB/ProBio или группе PB может быть связано с защитной ролью при СРК.В предыдущих исследованиях представители рода Akkermansia предлагались в качестве биомаркеров здорового кишечника [68,69,70]. В настоящем исследовании численность Akkermansia в модели PI-IBS значительно снизилась. Тем не менее, добавление пробиотических бактерий вместо самого ФБ может значительно повысить уровень Akkermansia . Этот результат может свидетельствовать о том, что живые бактерии могут стимулировать обилие Akkermansia , отличных от пребиотиков.Было показано, что количество бифидобактерий, обладающих укрепляющими здоровье свойствами, снижается в большинстве случаев СРК [12,71,72,73]. Одно исследование показало, что фруктаны инулинового типа и GOS способствуют росту лактобацилл или бифидобактерий [73]. Однако в нашем исследовании нет доказательств того, что PB или PB/ProBio могут увеличивать количество бифидобактерий.

PPAR содержат подсемейство из трех членов, включая PPARα, PPARβ/δ и PPARγ. PPARγ представляет собой активируемый липидами ядерный рецептор, контролирующий экспрессию генов, участвующих в метаболизме липидов и дифференцировке адипоцитов [74].Он экспрессируется не только в эпителиальных клетках кишечника (IECs), но также в кишечных макрофагах и T-клетках [75]. Сообщалось, что PPARγ ингибирует продукцию воспалительных цитокинов в различных типах клеток, вмешиваясь в TLR4-зависимый сигнальный путь [76]. Клиническое исследование, сравнивающее здоровую контрольную группу с пациентами с болезнью Крона, показало, что экспрессия PPARγ в ткани кишечника пациентов с язвенным колитом (ЯК) была значительно снижена [77]. Более того, было показано, что пребиотики, такие как олигосахариды, могут снижать провоспалительные цитокины в клетках Caco-2 кишечника, и это снижение зависит от активации PPARγ [78].Используя протеомный анализ по сравнению с моделью PI-IBS, можно было бы предсказать, что PPARγ активируется в группе предварительной обработки PB в толстой кишке. Таким образом, мы дополнительно подтвердили с помощью вестерн-блоттинга. Этот результат подтвердил предыдущее исследование, показывающее, что PPARγ играет решающую роль в регулировании воспалительных состояний и ингибировании воспаления в кишечном тракте, что может предотвратить развитие PI-IBS.

Продукт PB представляет собой смесь пребиотиков и антоцианов природного происхождения.По сравнению с пробиотическими бактериями потребление пребиотиков безопаснее для здоровья человека, хотя они могут быть и не совсем безопасными, о чем мы поговорим позже. Ключевые аспекты безопасности при использовании пробиотических штаммов включают системные инфекции, вредную метаболическую активность, чрезмерную иммунную стимуляцию у восприимчивых людей и перенос генов [79]. В нашем исследовании пребиотический продукт PB сам по себе обладает такой же способностью предотвращать СРК на мышиной модели, как и добавка пробиотических бактерий.С другой стороны, считается, что пребиотики более стабильны при хранении и транспортировке.

Хотя в этом исследовании смесь пребиотиков может эффективно улучшать симптомы СРК, и многие исследования показали, что пребиотики могут помочь с устойчивостью к желудочно-кишечным инфекциям [80], есть несколько исследований о том, как определенные пребиотики увеличивают потенциальную возможность заражения к определенным возбудителям. I M J Bovee-Oudenhoven et al. еще в 2004 г. показали, что быстро ферментируемый инулин и ФОС снижали резистентность крыс к сальмонеллам [81].Кроме того, было обнаружено, что у мышей, получавших рацион с высоким содержанием клетчатки, наблюдалось от 10 до 100-кратное увеличение колонизации токсином шига Escherichia coli O157:H7 и смертность на 25% выше по сравнению с группой, получавшей рацион с низким содержанием клетчатки. [82]. Однако в нашем исследовании продукт PB мог ингибировать воспаление, вызванное сальмонеллой, in vitro, а , Trichinella Spiralis , индуцировал воспаление in vivo. Возможно, потребуется провести дальнейшие исследования, чтобы доказать, увеличивает ли продукт PB риск заражения другими патогенами.

В совокупности результаты этого исследования показали, что новый пребиотический продукт PB может ослаблять воспалительную реакцию как в клетках Caco-2, так и в мышиной модели PI-IBS. Предварительное введение фенобарбитала мышам значительно уменьшило тяжесть симптомов СРК, что обеспечивает биологическую достоверность полезности этого пребиотического продукта. Важно отметить, что мы показали, что вызванные инфекцией кишечные бактериальные сдвиги могут быть обращены вспять продуктом PB по сравнению с отрицательным контролем.Мы также обнаружили, что передача сигналов PPARγ имеет прямую связь с противовоспалительным действием фенобарбитала, но в этом исследовании нельзя определить конкретный сигнальный путь. Пребиотики недороги, неинвазивны и безопасны в использовании. Таким образом, наши результаты обеспечивают основу для применения этого PB для предотвращения IBS в популяции людей. Необходимы дальнейшие исследования для подтверждения профилактической эффективности у пациентов с СРК. Для понимания точного механизма этой функции необходимы хорошо спланированные исследования.В совокупности, в качестве нового пребиотического продукта, ежедневные диетические вмешательства с использованием ПБ могут быть кандидатом на профилактику СРК. С другой стороны, некоторые пребиотики играют роль потенциальной угрозы для определенных желудочно-кишечных инфекций. Перед клиническим применением этого продукта предполагается проведение достаточного количества рандомизированных контролируемых исследований (РКИ) и необходимых оценок безопасности.

Смесь пребиотиков – Flourish

«Все болезни начинаются в кишечнике».
– Гиппократ, ок.2500 лет назад

Очевидно, что Гиппократ что-то понял, так как с каждым днем ​​все больше исследований показывают, насколько важным и влиятельным на самом деле является кишечник.

Как и наши отпечатки пальцев, наш кишечный микробиом уникален для каждого из нас. Он содержит более 1500 различных видов пробиотиков, бактерий, которые живут и процветают в нашем кишечнике, чтобы поддерживать баланс и здоровье организма.

Поскольку наш кишечный микробиом уникален для каждого из нас, уровни каждого пробиотического вида и общее количество пробиотических видов, содержащихся в нем, будут варьироваться в зависимости от человека.

Поддержание здорового баланса пробиотиков в кишечнике сводится к кормлению существующими пробиотиками, а не просто их добавлению.

  • Корень цикория
  • Мука из зеленого банана
  • True Cinnamon (цейлонская корица)
  • Кардамон
  • Какао
  • Анисовое семя
  • Семена фенхеля
  • Апельсиновая корка
  • Имбирь

ПОРЦИИ В УПАКОВКЕ: 60

РАЗМЕР ПОРЦИИ: 4 г

сред.количество за порцию за 100 г
ЭНЕРГИЯ 43.88KJ 1097KJ
БЕЛОК 0.24 г 6,1 г
ФАТ 0,1 г 2,6 г
Мононенасыщенные 0.06г 1,5 г
Полиненасыщенные 0,02 г 0,5 г
Насыщенный 0.02г 0,6 г
УГЛЕВОДЫ 1,17 г 29,3 г
Сахар 0.23г 5,7 г
НАТРИЙ 12 мг 300 мг
Как использовать:

Большинство пробиотических добавок содержат только 10-15 различных видов пробиотиков.Когда вы принимаете эти пробиотики, в кишечнике пополняются только те бактерии, которые содержатся в добавке, а это означает, что более 1000 других видов останутся проигнорированными и голодными.

Пробиотики едят пребиотики. Чтобы питать все виды пробиотиков в кишечнике (а не только 10-15 из них), вам нужно есть пребиотики.

Поскольку организм всегда находит равновесие и равновесие, пребиотики будут питать только те пробиотики в кишечнике, которые нуждаются в пополнении.

С цельной пищей, пребиотической добавкой на растительной основе, такой как наша смесь пребиотиков, ваш уникальный микробиом может сам решить, какие пробиотики кормить, чтобы лучше сбалансировать бактерии в вашем кишечнике.

Потому что чем здоровее микробиом вашего кишечника, тем здоровее вы.

Цельные продукты растительного происхождения, чистые

Как и пребиотики, резистентный крахмал является еще одним типом пищи для пробиотиков и назван в честь его устойчивости к всасыванию в верхних отделах желудочно-кишечного тракта.

Вместо этого он обходит верхнюю часть в пользу нижней части кишечного тракта, где пробиотики в кишечном микробиоме проводят свое время.

Инулиновое волокно, которое естественным образом содержится в корне цикория, является одной из форм пребиотика, которую пробиотики любят есть. Мы используем корень цикория в качестве ключевого ингредиента в нашей пребиотической смеси, чтобы гарантировать, что бактерии в нашем кишечном микробиоме получают пищу, необходимую им для процветания.

Зеленые бананы — это еще одна форма резистентного крахмала, которую пробиотики в кишечном микробиоме любят есть.Вот почему это еще один ключевой ингредиент нашей полезной для кишечника смеси.

Общие проблемы со здоровьем пищеварительной системы:

  • Болезнь Крона
  • Диарея
  • Запор
  • Синдром повышенной кишечной проницаемости
  • Синдром раздраженного кишечника
  • Язвенный колит

Также можно помочь с:

  • Слабая иммунная система (потому что ваша иммунная система начинается в кишечнике)
  • Проблемы с щитовидной железой
  • Улучшение настроения
  • Улучшение пищеварения

Размер порции

Начните медленно с половины чайной ложки в течение первых 2-3 недель, а затем доведите до целой чайной ложки.

Для людей с болезнью Крона и язвенным колитом половина чайной ложки может быть всем, что вы можете переносить. Может пройти 2-3 недели, прежде чем вы заметите результаты (уменьшение вздутия живота, твердый стул, регулярная легкая дефекация, уменьшение болей после еды и т. д.).

Полезный совет

Если после еды вы испытываете метеоризм, боль и газы, принимайте чайную ложку нашей смеси пребиотиков с половиной чайной ложки нашей смеси куркумы. Через 20 минут дискомфорт должен значительно уменьшиться.

Разработка смеси пребиотиков для влияния на эффекты ферментации in vitro с упором на пропионат в кишечнике | FEMS Микробиология Экология

Получить помощь с доступом

Институциональный доступ

Доступ к контенту с ограниченным доступом в Oxford Academic часто предоставляется посредством институциональных подписок и покупок. Если вы являетесь членом учреждения с активной учетной записью, вы можете получить доступ к контенту следующими способами:

Доступ на основе IP

Как правило, доступ предоставляется через институциональную сеть к диапазону IP-адресов.Эта аутентификация происходит автоматически, и невозможно выйти из учетной записи с проверкой подлинности IP.

Войдите через свое учреждение

Выберите этот вариант, чтобы получить удаленный доступ за пределами вашего учреждения.

Технология Shibboleth/Open Athens используется для обеспечения единого входа между веб-сайтом вашего учебного заведения и Oxford Academic.

  1. Щелкните Войти через свое учреждение.
  2. Выберите свое учреждение из предоставленного списка, после чего вы перейдете на веб-сайт вашего учреждения для входа.
  3. Находясь на сайте учреждения, используйте учетные данные, предоставленные вашим учреждением. Не используйте личную учетную запись Oxford Academic.
  4. После успешного входа вы вернетесь в Oxford Academic.

Если вашего учреждения нет в списке или вы не можете войти на веб-сайт своего учреждения, обратитесь к своему библиотекарю или администратору.

Вход с помощью читательского билета

Введите номер своего читательского билета, чтобы войти в систему. Если вы не можете войти в систему, обратитесь к своему библиотекарю.

Члены общества

Многие общества предлагают своим членам доступ к своим журналам с помощью единого входа между веб-сайтом общества и Oxford Academic. Из журнала Oxford Academic:

  1. Щелкните Войти через сайт сообщества.
  2. При посещении сайта общества используйте учетные данные, предоставленные этим обществом. Не используйте личную учетную запись Oxford Academic.
  3. После успешного входа вы вернетесь в Oxford Academic.

Если у вас нет учетной записи сообщества или вы забыли свое имя пользователя или пароль, обратитесь в свое общество.

Некоторые общества используют личные аккаунты Oxford Academic для своих членов.

Личный кабинет

Личную учетную запись можно использовать для получения оповещений по электронной почте, сохранения результатов поиска, покупки контента и активации подписок.

Некоторые общества используют личные учетные записи Oxford Academic для предоставления доступа своим членам.

Институциональная администрация

Для библиотекарей и администраторов ваша личная учетная запись также предоставляет доступ к управлению институциональной учетной записью.Здесь вы найдете параметры для просмотра и активации подписок, управления институциональными настройками и параметрами доступа, доступа к статистике использования и т. д.

Просмотр ваших зарегистрированных учетных записей

Вы можете одновременно войти в свою личную учетную запись и учетную запись своего учреждения. Щелкните значок учетной записи в левом верхнем углу, чтобы просмотреть учетные записи, в которые вы вошли, и получить доступ к функциям управления учетной записью.

Выполнен вход, но нет доступа к содержимому

Oxford Academic предлагает широкий ассортимент продукции.Подписка учреждения может не распространяться на контент, к которому вы пытаетесь получить доступ. Если вы считаете, что у вас должен быть доступ к этому контенту, обратитесь к своему библиотекарю.

Нужна ли мне пребиотическая добавка?

Ваш кишечник — это оживленное сообщество, состоящее из триллионов микроорганизмов, известных как кишечный микробиом. Исследователи только начинают открывать для себя множество чудес и преимуществ этого шумного города, живущего в вашем пищеварительном тракте.

Хотя сообщество микроорганизмов, живущих в вашем кишечнике, так же уникально для вас, как ваши отпечатки пальцев, оно изменчиво. Пребиотики и пробиотики играют важную роль в создании этих изменений — обычно к лучшему. Фактически, ранние исследования показывают, что состав вашего микробиома может влиять на риск развития хронических заболеваний, таких как воспалительное заболевание кишечника (СРК) или диабет 2 типа.

Вы можете знать о пробиотиках, но как насчет пребиотиков? Вам тоже нужна пребиотическая добавка?

Что такое пребиотики?

Пребиотики — это тип клетчатки, которая служит источником пищи для микроорганизмов (также известных как пробиотики) в кишечнике.Концепция пребиотиков была впервые введена в 1995 году и описана как неперевариваемое пищевое вещество, стимулирующее рост бактерий в толстой кишке.

После нескольких лет исследований Международная научная ассоциация пробиотиков и пребиотиков (ISAPP) в 2008 году разработала новое определение пребиотиков. По их словам, диетический пребиотик — это «выборочно ферментированный ингредиент, который приводит к специфическим изменениям в составе и/или активности пищевых продуктов». микробиоты желудочно-кишечного тракта, что благотворно влияет на здоровье хозяина.”

Джули Стефански, MEd, RDN, CSSD, LDN, CDCES, FAND, является владельцем Stefanski Nutrition Services, старшим редактором по продуктам питания и питанию в Good-Heart Wilcox и представителем Академии питания и диетологии (AND). Она говорит, что по мере ферментации пребиотиков бактерии в кишечнике создают полезные вещества, которые питают как бактерии, так и клетки кишечника.

Наиболее известные пребиотики — это олигосахариды, представляющие собой углеводы, которые организму трудно переваривать.

Примеры пребиотиков

  • Фруктаны ― инулин и фруктоолигосахариды (ФОС)
  • Галактоолигосахариды (ГОС)
  • Резистентный крахмал (RS)
  • Полидекстроза
  • Пектин
  • Рамноза

    Хотя соединение, известное как флаванол какао, не является углеводом или типом клетчатки, оно также может соответствовать определению пребиотика. Есть некоторые свидетельства того, что это биоактивное соединение стимулирует активность некоторых полезных бактерий в кишечнике.Однако необходимы дополнительные исследования.

    Пребиотические добавки, которые вы найдете в Интернете или в местном магазине здоровой пищи, могут содержать один или несколько из этих известных пребиотиков в различных формах. Например, они могут использовать корень цикория в качестве источника инулина или картофельный крахмал в качестве источника резистентного крахмала.

    Преимущества добавок с пребиотиками 

    Большинство продуктов с высоким содержанием клетчатки естественным образом содержат пребиотики. Взрослым требуется от 21 до 38 граммов клетчатки в день. Подсчитано, что большинство американцев не могут удовлетворить свои ежедневные потребности в клетчатке.

    Пищевые волокна обладают многими преимуществами для здоровья, такими как улучшение перистальтики кишечника и снижение уровня холестерина. Это также источник пребиотиков.

    В отличие от клетчатки, для пребиотиков нет официальных диетических рекомендаций. Тем не менее, ISAPP предлагает 3 грамма пребиотиков в день для поддержания здоровья кишечника.

    Есть некоторые доказательства того, что добавки с пребиотиками могут принести пользу для здоровья, например уменьшить беспокойство и облегчить симптомы СРК. Исследователи также обнаружили, что детская смесь, содержащая пребиотики, может улучшить раннюю колонизацию полезных бактерий в кишечнике ребенка, создавая основу для постоянного микробиома, который влияет на здоровье на протяжении всей жизни.

    Однако, прежде чем вы начнете искать в Интернете добавку с пребиотиками, чтобы добавить ее в свой распорядок дня, вы можете дважды подумать, прежде чем тратить деньги на добавку с пребиотиками.

    Недостатки пребиотических добавок

    Пребиотики полезны для здоровья. Но нужно ли принимать добавки? Прежде чем инвестировать в пребиотические добавки, вы можете узнать о недостатках.

    Ограниченное доказательство

    Академия питания и диетологии говорит, что использование пищевых добавок для профилактики заболеваний, таких как пребиотики, не так полезно, как вы думаете.Кроме того, AND отмечает, что недостаточно доказательств того, что эти типы добавок обеспечивают какие-либо долгосрочные преимущества.

    Кроме того, большинство исследований пребиотических добавок включали только один известный класс пребиотиков — олигосахариды. Согласно обзорной статье, опубликованной в январском выпуске журнала Current Developments in Nutrition за январь 2018 года, каждый известный класс пребиотических волокон предлагает свой собственный набор преимуществ для здоровья.

    Хотя есть много доказательств, подтверждающих преимущества ферментации пребиотических волокон, таких как инулин и олигосахариды, другие типы могут быть столь же полезными или даже более полезными, по мнению авторов обзора.

    Отсутствие регламента

    В отличие от лекарств, FDA не регулирует пищевые добавки и не требует от производителей доказательств того, что их добавки работают, прежде чем они поступят на прилавки. Добавки могут содержать активные или скрытые ингредиенты, которые негативно влияют на организм или взаимодействуют с другими лекарствами.

    Неприятные побочные эффекты

    Вы также можете испытывать неприятные желудочно-кишечные побочные эффекты от пребиотических добавок. Поскольку они представляют собой разновидность клетчатки, они могут вызывать газообразование и вздутие живота.Однако эти побочные эффекты могут зависеть от вашего обычного потребления клетчатки и дозировки пребиотической добавки.

    Плохой заменитель настоящей еды

    Пищевые добавки подобны страховке. Они гарантируют, что ваш организм получает питательные вещества, необходимые ему для правильного функционирования. Тем не менее, добавки не соответствуют питательным веществам, которые вы получаете из настоящей пищи, и не являются хорошей заменой сбалансированного и разнообразного питания.

    По словам Стефански, когда вы берете одно питательное вещество из пищи и добавляете его в добавку, вы теряете «синергетические преимущества», которые вы получаете от других веществ, содержащихся в цельной пище.Другими словами, было бы лучше есть спаржу или бананы, два продукта, которые богаты пребиотиками, но также содержат другие ключевые питательные вещества.

    Не подходит для вашего кишечника

    Баланс микроорганизмов в кишечнике влияет на ваше здоровье и может определить, насколько хорошо вы переносите пребиотические добавки.

    «Новые исследования показывают, что при определенных желудочно-кишечных заболеваниях баланс бактерий может быть не таким, как у людей с хорошим здоровьем кишечника.Когда определенных семейств бактерий слишком много или слишком мало, ферментация пребиотической клетчатки может вызвать чрезмерное газообразование, вздутие живота и боль», — говорит Стефански.

    Вы всегда должны поговорить с врачом о пищевых добавках, прежде чем добавлять их в свой распорядок дня.

    Когда дело доходит до добавок с пребиотиками, просто недостаточно доказательств их пользы для здоровья.

    Пищевые источники пребиотиков

    Вместо того, чтобы тратить деньги на добавку, которая может не сработать и вызвать вздутие живота, почему бы не добавить в свой рацион натуральные источники пребиотиков.

    3

  • Одуванчик Greens
  • Asparagus
  • лук
  • чеснок
  • яблоки
  • арбуз
  • Peas
  • Chickweas
  • OATS
  • Barley
  • пшеницы Bran
  • 2

    Продукты, богатые пребиотиками, также являются хорошими источниками других полезных для здоровья питательных веществ, таких как пищевые волокна, витамины и минералы.

    Что насчет ИБС?

    Если у вас СРК и вы соблюдаете диету с низким содержанием FODMAP, вы можете быть немного осторожны при добавлении любого из этих продуктов в свой рацион.Большинство этих продуктов, богатых пребиотиками, также содержат короткоцепочечные углеводы (также известные как ферментируемые олиго-, ди-, моносахариды и полиолы или FODMAP), которых вам следует избегать, чтобы облегчить симптомы СРК.


    Однако диета с низким содержанием FODMAP — это временная исключающая диета, которая помогает определить продукты, которые могут или не могут способствовать возникновению симптомов СРК. Это не долгосрочный план диеты. Вы должны следовать диете с низким содержанием FODMAP только под руководством вашего лечащего врача и зарегистрированного диетолога.

    Слово из Веривелла

    В Verywell Fit мы стремимся предоставить факты, лежащие в основе причуд, особенно когда речь идет о продуктах и ​​привычках для здоровья, которые популярны, но могут не полностью основываться на науке. Когда дело доходит до растительных лекарственных средств и добавок, включая такие продукты, как пребиотики, будьте осторожны.

    Хотя есть некоторые предполагаемые преимущества для здоровья таких продуктов, как пребиотики, наука ограничена. Вместо того, чтобы искать продукт, который может не обеспечивать все, что заявлено на этикетке, мы предлагаем обратить внимание на достаточное количество клетчатки и гидратации, сбалансированное питание, хорошую гигиену сна, ежедневное движение и другие положительные факторы образа жизни, чтобы вы чувствовали себя лучше.

    Повышение уровня пребиотических волокон | GoBiotix

    Вздутие живота, запор и раздраженный кишечник — все это признаки дисбаланса хороших бактерий в организме по сравнению с плохими бактериями. Prebiotic Fiber Boost насыщен растворимой клетчаткой, которая питает полезные бактерии, позволяя им расти и размножаться.

    Наша веганская растворимая пищевая клетчатка растительного происхождения способствует продвижению веществ через пищеварительный тракт, поскольку они не могут быть полностью расщеплены организмом.Это помогает улучшить пищеварительную регулярность.

    Борьба с СРК и запорами с помощью клетчатки

    Регулярное добавление клетчатки в наш рацион может быть затруднено в нашем быстро меняющемся мире. Вот почему мы разработали Prebiotic Fiber Boost как самое быстрое и простое решение для добавления растворимой клетчатки в любой рацион. Это наша передовая смесь, которая способствует оптимальной пищеварительной функции, борется с запорами и помогает облегчить раздраженный кишечник.

    Он также помогает повысить уровень энергии и поддерживает мозг.Просто добавьте наш безвкусный пребиотик Fibre Boost в любой напиток, коктейль или даже суп на ходу.

    GoBiotix Prebiotic Fiber Boost:

    • ✅  Веганский
    • ✅  Без глютена
    • ✅  Без сахара
    • ✅  Без ГМО
    • ✅  Пищевая смесь

    Легко добавить в любую диету

    Растворимая пребиотическая клетчатка NUTRAFLORA, одна из самых эффективных пребиотических волокон и самая чистая форма короткоцепочечных фруктоолигосахаридов (scFOS), доступных на рынке, помогает повысить уровень полезных бактерий в толстой кишке, а научно доказано, что она поддерживает здоровье пищеварительной системы.

    Добавьте эту неароматизированную добавку пребиотических волокон без ГМО и глютена в свои смузи, кофе или любимый напиток и наслаждайтесь.

    Многие люди не включают в свой рацион достаточное количество пребиотических продуктов. В результате мы объединили мощные пищевые ингредиенты и пребиотические волокна в простую ежедневную порцию, чтобы вы могли чувствовать себя лучше!

    Просто выпейте наш порошок клетчатки без вкуса и наслаждайтесь многочисленными преимуществами, связанными с обменом веществ. Внедрение пребиотических продуктов в ваш рацион способствует оптимальной пищеварительной функции, ускоряет метаболизм и препятствует росту вредных бактерий.

    Основные ингредиенты

    Нутрафлора

    Наше пребиотическое волокно содержит Nutraflora FOS, который производится из не содержащей ГМО сахарозы (тростникового сахара). Nutraflora представляет собой растворимое пребиотическое волокно, которое на 30% слаще сахара, с меньшим количеством калорий и аналогичным профилем сладости. Это неперевариваемый углевод, который способствует росту полезных кишечных бактерий.

    Основные преимущества

    Поддержка органических и растительных кишечных бактерий

    Клинически проверенный и изготовленный из Nutraflora FOS, Prebiotic Fiber Boost представляет собой органическую смесь на пищевой основе с питательным составом, богатым полезными микро- и макроэлементами.

    Идеальный баланс

    Поддержание правильного баланса микробов в нашем пищеварительном тракте с помощью пребиотических продуктов способствует здоровому контролю веса, благодаря чему вы можете уменьшить вздутие живота.

    Оптимальная функция пищеварения для любой диеты

    Мы объединили мощные пищевые ингредиенты и пребиотические волокна для всех диет, включая диеты с низким содержанием углеводов, такие как кето-диета. примите простую ежедневную порцию, которая заставит вас выглядеть и чувствовать себя великолепно!

    Без искусственных или рафинированных сахаров

    Мы никогда не используем искусственный сахар, добавленные подсластители, очищенную муку или ингредиенты, содержащие гидрогенизированные масла, пестициды, гербициды, гормоны или антибиотики.Мы используем только натуральные пищевые ингредиенты высочайшего качества, которые являются органическими, пророщенными, веганскими и палео.

    9 лучших пробиотических и пребиотических добавок 2018

    Фото: Билл Вунш/Denver Post через Getty Images

    Есть много возможных путей улучшения состояния кожи, и один из них — через кишечник. Эта логика «ты есть то, что ты ешь» по крайней мере частично объясняет, почему в последние годы пробиотики поднялись от безвестности йогурта «Активиа» до популярности наравне с K-beauty.Пробиотики — по сути, хорошие бактерии — могут помочь с пищеварением, вагинальным здоровьем (пробиотические тампоны — вещь, и любимая Стратегами), коже, настроению и так далее, поэтому они стали основным компонентом для людей с самоконтролем. процедуры ухода. Что подводит нас к новейшей волне в области здоровья бактерий: пребиотикам.

    Пребиотики появились на сцене здравоохранения после пробиотиков, но это противоречит их пониманию: как следует из префикса, пребиотики — по сути, клетчатка — должны существовать как условие для процветания пробиотиков.«Я описываю пребиотик как подкормку для полезных членов микробиоты в желудочно-кишечном тракте», — говорит Боб Хаткинс, ученый-диетолог из Университета Небраски. «Нет никаких сомнений в том, что сейчас это горячая тема. Но вот уже 20 лет в исследовательском мире жарко. И теперь вы даже видите вещи о роли здоровья кишечника в вещах, о которых мы даже не думаем как о кишечнике, таких как аллергии, острота ума, снижение стресса».

    Пребиотики — это волокна, содержащиеся в таких продуктах, как бананы, лук-порей и чеснок.(Любой, с кем вы заговорите, сначала скажет вам, что эти продукты — самый простой способ увеличить потребление пребиотиков.) Основываясь на исследованиях таких ученых, как Хаткинс и его коллеги из Международной научной ассоциации пробиотиков и пребиотиков, есть много доказательств, позволяющих предположить что организм некоторых людей может получить больше пользы от пробиотиков (которые также содержатся в настоящих продуктах, таких как йогурт и квашеная капуста), если они принимают их с пребиотиками.

    Итак, обещание: все, что вы хотите от пробиотиков — улучшение пищеварения, более чистая кожа, меньшее количество дрожжевых инфекций — может быть максимизировано, сочетая их с пребиотиками.Но, как и в случае с уходом за кожей или даже просто с обычным питанием, успех с пребиотиками приходит к тем, кто экспериментирует. Многие врачи будут предостерегать потребителей от трат на них, пока не появятся надежные клинические исследования, доказывающие эффективность пробиотиков, пребиотиков и других добавок. Но многим из нас не нужны клинические испытания, чтобы узнать, что мы лучше спим или меньше болит живот. Всем, кто интересуется пребиотиками, Хаткинс советует искать капсулы или порошки, которые смешиваются со смузи, с этикетками, содержащими пребиотики инулин (полученный из цикория) или FOS или GOS (сокращение от определенных химических соединений клетчатки).Многие из них даже поставляются с пробиотиками. Не существует жесткого и быстрого правила, объясняющего, почему определенные волокна способствуют процветанию определенной флоры, но в этом нет ничего плохого. Даже врачи, поддерживающие клинические испытания, скажут вам, что нужно прислушиваться к своему телу.

    The Nue Co., стильная линия добавок с акцентом на включение пребиотиков, смешивает пребиотический инулин, основанный на цикории, в своих капсулах Energy Food и Skin Food.Жюль Миллер основала Nue Co. после многих лет борьбы с хроническим синдромом раздраженного кишечника — не синдромом «я только что съела целую пиццу», как она говорит, а состоянием вздутия живота и усталости, которое в конечном итоге привело к тому, что ее штаны увеличились на три размера. Врачи посоветовали ей отказаться от молочных продуктов, а затем от сахара, а затем от пшеницы, но в конечном итоге Миллер обнаружила, что сырые овощи больше всего вредят ее организму и что смесь полностью натуральных порошковых добавок пре- и пробиотиков облегчила ее болезни. В состав входит порошок из плодов лукумы и баобаба, которые содержат витамины С и Е для осветления кожи.

    Миллер называет Деблоат хорошим стартером для всех, у кого, как и у нее в прошлом, есть проблемы с пищеварением. Он содержит имбирь, который помогает успокоить желудок, и куркуму, противовоспалительное средство.

    Energy food содержит «богатую магнием смесь маки, ягод годжи и свеклы», которая заряжает вас энергией.

    RMS, один из первых брендов, начавших выпускать не содержащую химикатов косметику, которую можно есть, например, этот хайлайтер, который нравится бьюти-писателю Рио Вьера-Ньютон, недавно выпустил комбинацию пребиотиков и пробиотиков в капсулах.

    Seed — это новейшая разработка в области пребиотиков и пробиотиков. Компания Seed, запущенная ранее этим летом, на данный момент имеет два доступных продукта: синбиотик (термин, используемый для пре- и пробиотиков) для мужского организма и один для женского организма. Каждый из них включает 24 встречающихся в природе штамма бактерий растительного происхождения, которые были признаны полезными для вашего кишечника и тела Грегором Ридом, председателем Экспертной группы по пробиотикам Всемирной организации здравоохранения Организации Объединенных Наций.Также их берет Карли Клосс. Seed основан на модели подписки: 50 долларов в месяц дают вам 90 планшетов; вы также храните свою прекрасную банку, а Seed отправляет вам добавку в компостируемой упаковке.

    BioSchwartz, одна из самых просматриваемых и любимых комбинированных добавок пребиотиков и пробиотиков на Amazon, получила пять звездных комментариев от пользователей, которые говорят, что она помогает при проблемах с пищеварением.

    Еще один продукт с восторженными отзывами на Amazon, Dr.Продукты Tobias — это просто пребиотики. Метод проб и ошибок является правилом с ними, но теоретически они могут быть добавлены к режиму, который уже включает хороший пробиотик.

    А если у вас есть проблемы с глотанием таблеток: жевательные резинки с пребиотиками — вариант.

    Увлажняющий крем для лица

    Proactiv содержит «питательный пребиотик», который «предназначен для естественной защиты кожи.Другими словами: точно так же, как пребиотики могут питать полезные бактерии в кишечнике, они также могут питать полезные бактерии на вашей коже. Для людей с чувствительной или склонной к высыпаниям кожей это может быть полезным способом восстановить баланс.

    Пребиотическая термальная вода La Roche-Posay следует той же логике, что и средство для умывания Proactiv, но для всего тела и микробиома. Если чувствительная или чрезмерно сухая кожа является проблемой, этот увлажняющий крем предназначен для помощи.

    получить информационный бюллетень стратега

    Действительно выгодные предложения, умные советы по покупкам и эксклюзивные скидки.

    Vox Media, LLC Условия и уведомление о конфиденциальности

    The Strategist предназначен для предоставления наиболее полезных экспертных рекомендаций по покупкам в обширном пространстве электронной коммерции.Некоторые из наших последних завоеваний включают лучшие Женские джинсы , , Rolling Covanting , подушки для боковых спящих , Ультрастрализующиеся штаны и Банные полотенца . Мы обновляем ссылки, когда это возможно, но имейте в виду, что срок действия сделок может истечь, и все цены могут быть изменены.

    Каждый редакционный продукт выбирается независимо. Если вы покупаете что-то по нашим ссылкам, New York может заработать партнерскую комиссию.

    Добавить комментарий

    Ваш адрес email не будет опубликован.