Дисбиоз кишечника что такое: Дисбактериоз кишечника: симптомы, коррекция и лечение дисбиоза у взрослых и детей, степени, анализы и профилактика

Содержание

Дисбактериоз кишечника: симптомы, коррекция и лечение дисбиоза у взрослых и детей, степени, анализы и профилактика

Дисбактериозом (дисбиоз) называют симптоматическое состояние, характеризующееся нарушением микрофлоры кишечника. В кишечнике в этот момент размножаются патологические бактерии, и нарушается естественный микробный баланс.

Причины дисбактериоза

Существуют различные предпосылки и состояния, которые способны привести к развитию дисбактериоза:

  • заболевания органов ЖКТ,
  • прием лекарственных препаратов, нарушающих микрофлору кишечника (антибиотики),
  • неправильное питание,
  • физиологические возрастные изменения,
  • прием гормональных препаратов,
  • курсы лучевой и химиотерапии,
  • стрессы и неправильный режим дня,
  • пищевые отравления,
  • инфекционные процессы в организме.

Банальные респираторные инфекции или аллергические заболевания могут стать причиной нарушения микрофлоры кишечника, так как в этот период пациенту могут назначаться различные лекарственные препараты, негативно влияющие на микробный баланс.

Как понять, что у вас дисбиоз?

На разных стадиях заболевания симптоматика дисбактериоза различна. Специалисты рекомендуют обращать внимание на следующие проявления:

  • отрыжка,
  • тошнота,
  • урчащие звуки в животе,
  • вздутие и метеоризм,
  • ноющие или режущие боли в области живота,
  • запоры либо диарея и жидкий стул,
  • сухость кожных покровов,
  • неприятный привкус и запах изо рта,
  • утомляемость и нарушение сна.

Наличие одного или нескольких перечисленных симптомов – повод обратиться к врачу.

Диагностика дисбактериоза

Самостоятельно диагностировать состояние дисбактериоза невозможно. Поставить точный диагноз способен только опытный специалист, который обследует пациента при помощи лабораторных методов и специальной аппаратуры. Обратившись за медицинской помощью, пациент проходит обследование, которое включает:

  • исследования мочи и кала,
  • ПЦР-диагностику микрофлоры,
  • визуальный осмотр кожных покровов.

Профилактика дисбактериоза

Развитие заболевания можно предотвратить, если внимательно следить за питанием, избегать стрессовых состояний, соблюдать режим сна и отдыха, не употреблять необоснованных лекарственных препаратов, занимаясь самолечением, контролировать состояние органов желудочно-кишечного тракта.

Что будет, если не лечить дисбактериоз?

Если не лечить дисбиоз, заболевание может перейти в более тяжелую форму, и не исключено появление осложнений. В результате этих процессов в кишечнике будут образовываться токсические вещества, которые с кровотоком будут разнесены по всем органам и тканям. Всасывание и усвоение минералов и витаминов будет нарушено, иммунитет организма ослабнет, и защитные свойства значительно снизятся. Пациент будет легко подвержен различным инфекциям, банальное расстройство кишечника может привести к серьезным заболеваниям, лечение которых нередко требует оперативного вмешательства.

Как вылечить дисбактериоз?

При лечении дисбактериоза важнейшим шагом становится лечение основного заболевания, которое вызвало патологию в кишечнике пациента. Затем проводится терапия по восстановлению микрофлоры кишечника, наиболее правильно подбирать препараты на основе лабораторных исследований посева.

Диета при дисбактериозе

В период лечения и для предупреждения рецидивов необходимо исключить употребление жирного, острого, соленого, жареного, не пить алкоголь. Питание должно быть сбалансированным и щадящим, в рационе должны присутствовать кисломолочные продукты.

Проконсультироваться о диагностике и лечении дисбактериоза и записаться к специалисту вы можете, позвонив в нашу клинику или записавшись через форму на сайте.

УЗНАТЬ ЦЕНЫ

ABC-медицина

При эубиозе (то есть в норме) микрофлора кишечника представляет собой оптимальное соотношение различных бактерий – кишечной палочки, лактобацилл, энтерококков и др., всего более 500 видов. Дисбактериозом называют дисбаланс микробов, который длится продолжительное время. Это очень распространенное состояние, встречающееся примерно у 90 % взрослых и 95 % детей.

При должной коррекции, которую может назначить только врач, дисбактериоз кишечника проходит, но при отсутствии лечения обычно переходит в более тяжелую, прогрессирующую форму. Данное бактериологическое состояние принято рассматривать в качестве проявления или осложнения какого-либо заболевания, чаще всего – желудочно-кишечного тракта.

Причины развития дисбактериоза

Гибель полезных бактерий, населяющих микрофлору кишечника, может быть связана с такими факторами, как:

  • изменение функций желудка, поджелудочной железы или печени, приводящее к недостатку пищеварительных ферментов и появлению непереваренных остатков пищи, которые способствуют росту болезнетворных микробов;
  • пониженный тонус гладкой мускулатуры кишечника или ее спазмы, возникающие в результате психического или физического стресса, хирургического вмешательства, вегетососудистой дистонии – все это приводит к нарушению передвижения пищевых масс;
  • различные заболевания желудочно-кишечного тракта, такие как холецистит, гастрит, панкреатит и пр., связанные с повышением кислотности или щелочности среды обитания бактерий, что влечет за собой изменение обмена веществ и клеточных мембран полезных микроорганизмов;
  • неправильное пищевое поведение (диеты, недостаток кисломолочных продуктов и клетчатки, употребление консервантов) препятствует нормальному росту полезных микробов или провоцирует их уничтожение;
  • наличие в кишечнике паразитов или болезнетворных микробов, чьи продукты жизнедеятельности убивают полезные микроорганизмы – обычно это связано с дизентерией, сальмонеллезом, вирусными заболеваниями и пр.;
  • прием антибиотиков, пагубно действующих не только на вредных микробов, но и на полезных.

К факторам, повышающим риск развития дисбактериоза кишечника, относят постоянные стрессы и неблагоприятную экологию, от которых страдают жители современных мегаполисов.

Общая симптоматика

Симптомы дисбактериоза кишечника различаются по локализации дисбиотических изменений и степени их выраженности. На тяжесть клинических проявлений влияют возраст, образ жизни, состояние иммунной системы, стадия развития патологии.

1 стадия

На данном этапе дисбаланс бактерий выражен слабо: пациента могут беспокоить небольшие расстройства кишечника. Обычно такое состояние связано с кратковременным воздействием на микрофлору, например, со сменой привычной пищи, напитков. После окончания воздействия провоцирующих факторов или привыкания к новым условиям баланс микрофлоры восстанавливается.

2 стадия

Прекращается производство кишечником необходимого количества ферментов, обеспечивающих нормальное пищеварение. В результате возникает процесс брожения, который проявляется болью и вздутием живота, горечью во рту, метеоризмом, запорами или, наоборот, диареей. Это могут быть симптомы как прогрессирующего дисбактериоза, так и развития заболеваний желудочно-кишечного тракта.

3 стадия

На этой стадии при воздействии большого количества патогенной флоры на стенки кишечника развивается воспалительный процесс. Такой дисбактериоз уже требует медицинского вмешательства. К выраженным симптомам добавляются тошнота, рвота, непереваренные фрагменты пищи в стуле, сильные боли в животе. В некоторых случаях – повышение температуры тела.

4 стадия

Это состояние кишечника, при котором нормальная микрофлора практически полностью вытеснена болезнетворными микроорганизмами, что приводит к нарушению всасывания полезных веществ, развитию авитаминоза и даже анемии. Образующиеся в результате токсины попадают в кровь и провоцируют тяжелые аллергические реакции. Клинические проявления включают возникновение сыпи, экземы, крапивницы, возможно развитие астмы, бессонницы, хронической усталости. Пациент может жаловаться на проблемы с концентрацией внимания. При отсутствии своевременного лечения возникает угроза развития тяжелых кишечных инфекций.

Крайняя степень дисбактериоза – проникновение бактерий желудочно-кишечного тракта в кровь (бактериемия), в некоторых случаях – развитие сепсиса.

Диагностика дисбактериоза

Основная цель диагностики – определение вида микробов, заселяющих кишечник, и их количества. Как правило, используются следующие основные методы:

  • бактериологическое исследование, на качество результатов которого влияют соблюдение сроков доставки и сохранности материала, а также условий культивирования разных видов бактерий;
  • исследование метаболитов микрофлоры, которое основано на определении летучих жирных кислот, выделяемых микроорганизмами. Отличается точностью результатов, простотой и оперативностью выполнения.

При проведении диагностики и постановке диагноза учитывается также, что микрофлора кишечника индивидуальна для каждого человека. Ее состав может зависеть от возраста, потребляемой пищи и сезона. В связи с этим специалист основывается не только на результатах анализов, но и на дополнительных обследованиях, позволяющих выявить причину развития дисбактериоза.

Лечение дисбактериоза

Лечение дисбактериоза у взрослых зависит от причин и симптомов и назначается комплексно. Стандартная схема обычно включает меры, направленные на:

  • устранение избыточности патогенных микроорганизмов;
  • восстановление нормальной микрофлоры;
  • улучшение процесса пищеварения;
  • нормализацию моторики кишечника;
  • стимулирование реактивности всего организма.

Помните, что назначить грамотное и эффективное лечение может только специалист. Чтобы получить квалифицированную консультацию, запишитесь на прием к врачу клиники «АВС-Медицина» по номеру +7 (495) 223-38-83 или заполните заявку на нашем сайте.

Дисбактериоз кишечника. Как лечить дисбактериоз

Организм человека – очень сложная и слаженная система, для нормальной работы которой важно поддержание внутреннего баланса. Но у организма есть и помощники – полезные бактерии, живущие в кишечнике. Они помогают переваривать пищу, получать питательные вещества, более того, они необходимы для работы иммунной системы и защищают организм от распространения вредных, патогенных бактерий. Однако иногда баланс микроорганизмов нарушается, что приводит к неприятным последствиям – развивается дисбактериоз.

Дисбактериоз кишечника – это нарушение состава нормальной микрофлоры кишечника. Количество полезных бактерий снижается, а патогенные микроорганизмы начинают усиленно размножаться. Это заболевание приводит к расстройству пищеварения, дефициту некоторых микроэлементов, снижению иммунитета и плохому самочувствию.

Дисбактериоз кишечника встречается очень часто: по некоторым данным ему подвержены до 90% всех взрослых людей. Еще чаще возникает дисбактериоз кишечника у детей – 95% грудных малышей страдают от этого заболевания. Причин дисбактериоза множество: плохая экология, хронический стресс, неправильное питание. Кроме того, дисбактериоз кишечника может быть вызван бесконтрольным применением антибиотиков и иммунодепрессантов. У детей он часто возникает в связи с переходом на искусственное вскармливание. В то время как грудное молоко богато полезными микроорганизмами и помогает заселить ими кишечник ребенка, искусственные смеси могут нарушить состав микрофлоры и привести к дисбактериозу.

Как лечить дисбактериоз?

Если по тем или иным причинам баланс нормальной кишечной микрофлоры был нарушен и развился дисбактериоз кишечника, лечение лучше начинать сразу, до перехода состояния в затяжную форму и развития более серьезных симптомов. Лечение дисбактериоза должно быть комплексным, поэтому как лечить дисбактериоз в каждом конкретном случае лучше всего расскажет лечащий врач. Дело в том, что дисбактериоз не является самостоятельным заболеванием и может быть симптомом различных болезней, чтобы избавиться от дисбактериоза, необходимо вылечить в первую очередь заболевание его вызвавшее.

Тем не менее, существуют общие рекомендации по лечению дисбактериоза кишечника. Для нормализации состава микрофлоры кишечника применяют, так называемые, бактериальные препараты, например, Линекс, Бификол, Энтерол и другие. Эти препараты содержат живые культуры, характерные для нормальной микрофлоры и помогут восстановить баланс. Кроме того, при дисбактериозе полезно употребление продуктов, содержащих лактобактерии и бифидобактерии. Для нормализации работы пищеварительной системы стоит исключить из рациона продукты, раздражающие слизистую кишечника, т.е. на время отказаться от острого, соленого и маринованного. Для того, чтобы предотвратить распространение патогенных микроорганизмов при дисбактериозе кишечника иногда применяют антибактериальные препараты. Однако выбор препарата и продолжительность курса должен оценивать врач. Применение антибиотиков без рекомендации врача может привести к усугублению дисбактериоза.

Ещё статьи:

Дисбактериоз кишечника - чем он опасен для детей

30/10/2018

Почему такой болезни, как дисбактериоз не знают врачи Европы и Америки. Существует три чисто Российских заболевания, неизвестных на Западе: ВСД, остеохондроз и дисбактериоз. Поговорим о дисбактериозе кишечника.

Антибиотик и дисбактериоз.

Прежде всего, о причине, которая заставила меня углубиться в эту проблему. Занимаясь почти 30 лет педиатрической практикой, приходится наблюдать,как необоснованно  распространилась мода на диагноз дисбактериоза кишечника. Однажды я был поражен негативной реакцией родителей на назначение антибиотика ребенку, у которого выявили пневмонию. Нет, нет, никаких антибиотиков, мы только что вылечили дисбактериоз – с негодованием заявила мама ребенка. Страх перед поносом, преобладал над страхом болезни. Конечно же нисколько при этом не умоляя неприятностей, доставляемых дисфункциями кишечного тракта, я понял, что медицинская пропаганда по проблеме дисбактериоза кишечника и нормализации кишечной флоры перестаралась.

Отыщи всему начало, и ты многое поймешь

(К. Прутков)

Немного углубимся в  историю. В послевоенные годы началась эра антибиотиков. Начиная с 60-ти десятых годов новые антибиотики появлялись чуть ли не каждый год. Эйфория была необыкновенная. Пневмонии, гнойные менингиты перестали быть фатально смертельными, остановилась эпидемия ревматизма, перитонит можно вылечить. Антибиотиками стали лечить все не свете: рак, насморк, язвенную болезнь желудка, вот-вот должен быть побежден туберкулез и т.д. Увеличивались дозы, удлинялись курсы лечения, возникали схемы по чередованию курсов разных антибиотиков и их комбинации. В студенческой песне Саратовских медиков в одном куплете это четко отражено.

… Головы не надо в медицине,

дело все друзья в пенициллине.

Лей дружище сколько можно,

внутривенно и подкожно,

внутримышечно в глютеос и пер ос …

И вдруг появились больные с кандидозами, грибковым сепсисом, появились статьи о связи хронической диареи с длительным приемом антибиотиков, чаще стали регистрироваться устойчивые штаммы бактерий все к большим группам антибиотиков. Стало понятно, что не все так просто. Вспомнили о русском дореволюционном ученом Илье Мечникове, нобелевского лауреата по медицине за работы по клеточному иммунитету – фагоцитозу. В одной из его работ по удлинению жизни до библейских лет, говорилось о хороших микробах, живущих в кишечнике. И что, в случаи их подмены на плохие, возникает дисбаланс в кишечнике и как следствие ведет к укорочение жизни человека. Появился термин дисбактериоз, как симптом, возникающий после кишечных инфекций или в следствии длительной антибиотикотерапии. Уже в восьмидесятых, симптом дисбактериоза был переведен в самостоятельную нозологическую единицу и стал считаться хронической болезнью на территории СССР и социалистического лагеря.

Немножко о Мечникове. Это был прекрасный ученый и вместе с тем, очень тяжелый человек с которым не уживался ни один научный коллектив.

Мечников Илья Ильич родился 15 мая 1845г., в семье офицера царской охраны Ильи Ивановича и Эмили Львовны. У Ильи было 4 брата и 1 сестра, особенно близкие отношение сформировались с братом Колей, с которым он особенно часто и усердно любил соревноваться. Изначально семья Мечниковых жила в Петербурге, однако пышные балы и рауты пришлось сменить на провинциальную Панасовку в Харьковской волости из-за чрезмерного пристрастия Ильи Ивановича к азартным играм.
             Всю жизнь он доказывал, что он не провинциальный тюфяк, что он самый, самый. Сперва своим старшим братьям, затем в Харьковской гимназии №2, окончив её с золотой медалью. Затем в универе закончив его всего за 2 года. Спорить он не умел, считая своих оппонентов ничтожествами. Возражения не терпел, начинал обзываться и лезть в драку. Спасибо, что дуэли к этому времени были под запретом, а то из-за своего характера прожил бы не дольше Пушкина. Так что в России долго не задержался. Он работал по многим направлениям. Мечников занимался изучением холеры, возвратного тифа, сифилиса, формирует концепцию ортогенеза, дорабатывает свою фагоцитарную теорию.

Когда теория Мечникова о роли фагоцитоза и функции лейкоцитов получила признание в научном мире, он начал работу над проблемами старения и смерти. Стремясь отдалить смерть, Мечников тщательно следил за образом жизни: пил лишь кипяченую воду, никогда не ел немытые плоды, не употреблял алкоголь.

В 1903 г ученый опубликовал книгу, посвященную “ортобиозу”, или “умению жить правильно”, которая называлась “Этюды о природе человека”. В этом труде Мечников доказывал, каким огромным является влияние питания на продолжительность жизни. Он был убежден, что для долголетия нужно употреблять большое количество кисломолочных продуктов или кефира, заквашенного болгарской палочкой.

Известно предложение И.И. Мечникова даже удалять прямую кишку для поддержания здоровья и долголетия. И это практиковалось в Англии в начале 20 века. Мечниковская мысль о вреде самого наличия толстой кишки была взята на вооружение в Великобритании: только один хирург крупного медицинского центра London's Guy's Hospital сэр В.А. Лейн (Sir William Arbuthnot Lane) между 1900 и 1920 годами удалил толстую кишку у сотен англичан с запорами. Хирург Дж.Келлогг разработал и применял операционную методику, вызывавшую ускоренное движение пищевого комка по кишечнику. Любопытно, что в связи с этим предложением ученого Л.Н. Толстой записал в своем дневнике о том , что Мечников придумывает, как с помощью вырезания прямой кишки обезвредить старость и смерть. Будто бы без него и до него никто не думал, что старость и смерть не совсем приятны. Думали и прежде вас, г-н Мечников, говорил Л.Н. Толстой. И думали величайшие умы мира, и решали и решили вопрос о том, как обезвредить старость и смерть, только решали ученые этот вопрос умно, а не так, как вы: искали ответа на вопрос не в прямой кишке, а в духовном существе человека.

Учение о дисбактериозе тесно связано с представлением о необходимости постоянно следить за "чистотой" толстой кишки. Очистка кишечника (ОК) или гидроколонотерапия - это процедура, при которой несколько литр жидкости вводят через прямую кишку в кишечник, чтобы его промыть и удалить содержимое, то есть шлаки. Сторонники этой процедуры декларируют, что "все болезни и смерть начинаются в кишечнике", что ОК "очищает" организм, что регулярная очистка необходима для поддержания хорошего здоровья.

Рабочие гипотезы от частого употребления превращаются в аксиомы. Как заметил один доктор, проблема дисбактериоза обросла у нас таким огромным количеством фактов, что выглядит почти неприступной для критики.

Причины для обследования на дисбактериоз:

  • Диарея или неустойчивый стул с чередованием запоров и поносов, изменение макроскопических характеристик кала
  • Метеоризм или вздутие живота у детей грудного возраста
  • Низкая толерантность к определенным пищевым продуктам
  • Атопический дерматит и другие кожные проявления аллергии
  • Нарушения трофики ребенка связанные с мальабсорбцией или гиповитаминозом
  • Когда под видом дисбактериоза проводится лечение банальной кишечной инфекции, вызванной патогенной кишечной палочкой. К сожалению, честная диагностика кишечной инфекции порой чревата для участкового врача и тем более для его коллеги, практикующего в стационаре массой неприятностей.

Внимательно анализируя каждый конкретный случай якобы дисбактериоза, в большинстве случаев удается найти объяснение приведенной выше симптоматики и не прибегая к спасительному диагнозу дисбактериоз.

Дисбактериоз есть или нет.

Интересно, что практические врачи диагностируют дисбактериоз, не смотря на отрезвляющие голоса, которые звучат из достаточно авторитетных уст. Практика диагностики дисбактериоза, как самостоятельной нозологической единицы осуждена Российской ассоциацией гастроэнтерологов.

VI Российская гастроэнтерологическая неделя (организаторы РГА, РАН, РАМН и Минздрав России), состоявшаяся 23-27 октября 2000 г., в своей очень насыщенной программе (пять 8-часовых дней одновременно в трех помещениях) ни в одном докладе не упоминает о проблеме дисбактериоза и его коррекции. Впрочем, как и пять предыдущих. Причина тому проста: Российская гастроэнтерологическая ассоциация рассматривает лишь клинически обоснованные вопросы гастроэнтерологии.

Понятие дисбактериоза кишечника, как особого хронического состояния или даже болезни, ведущей к многочисленным внекишечным осложнениям, которую нужно обязательно исправлять или лечить, принимая определенные микробы, присуще только отечественной медицине. В этом можно легко убедиться. Осуществляя поиск в мировой научной базе данных по медицине (Медлайн) по ключевому слову "dysbacteriosis" (дисбактериоз), мы узнаем, что оно присутствует в заголовках 257 научных работ, опубликованных с 1966 по 2011 год, 250 из них - в русскоязычных медицинских журналах, еще 4 принадлежат авторам из прежнего социалистического лагеря.

Несложно догадаться, что и среди врачей нет единства мнений относительно того, что же такое этот дисбактериоз. По-разному выскажутся педиатр, иммунолог, микробиолог, аллерголог, инфекционист. Бактериолог заявит, что дисбактериоз -  это понятие чисто бактериологическое. Трудно ожидать заслуживающих доверия данных о значении насильственной ликвидации так называемого дисбактериоза для здоровья пока в это понятие не будет вложен хотя бы единый или определенный смысл. Российская гастроэнтерологическая ассоциация избегает использования этого термина и в Международной классификации болезней он также не упоминается.

Редакционная коллегия "Российского журнала гастроэнтерологии, гепатологии, колопроктологии" озабоченна продолжающимся до сих пор использованием в кругу практических врачей термина "дисбактериоз кишечника".  Соглашаясь   о бездоказательности многих положений, касающихся концепции "дисбактериоза кишечника", редколлегия хотела бы напомнить, что большинство ведущих российских гастроэнтерологов еще несколько лет назад осудило практику широкого использования диагноза "дисбактериоз кишечника" как порочную, поскольку это понятие не имеет присущей ему клинической составляющей. Диагностика "дисбактериоза", основанная на малоинформативных результатах бактериологического исследования кала, не имеет надлежащей верификации, а все свидетельства о высокой эффективности пробиотиков чаще всего базируются на субъективной оценке, а не на принципах доказательной медицины (см. "Диагностика и лечение синдрома раздраженной кишки Материалы "круглого стола".Российский журнал гастроэнтерологии,гепатологии, колопроктологии. -1999. -Т.9, № 2 -С.61-69). К сожалению, точка зрения о том, что корни многих гастроэнтерологических заболеваний следует искать в изменении состава микрофлоры толстой кишки, остается популярной среди ряда врачей и больных. В лучшем случае этот подход выражается в длительном и чаще всего бесполезном назначении так называемых пробиотиков (коли- и бифидумбактерина и других), а в худшем - в бесконтрольном применении антибиотиков с риском развития серьезных осложнений, в том числе и кишечных. Те симптомы, которые обычно приписываются дисбактериозу кишечника (периодические схваткообразные боли по ходу толстой кишки, метеоризм, расстройства стула с наклонностью к поносам, запорам или их чередованием), в действительности служат проявлением синдрома раздраженного кишечника или реже - скрыто протекающей лактазной недостаточности - заболевания, приведенного в Международной классификации болезней 10-го пересмотра и содержащего следующие рубрики (рубрика "дисбактериоз кишечника", к слову, в МКБ-10 отсутствует).

Рубрики синдрома раздраженного кишечника в МКБ-10: К58 Синдром раздраженного кишечника К58.0 Синдром раздраженного кишечника с диареей К58.9 Синдром раздраженного кишечника без диареи К59 Другие функциональные кишечные нарушения К59.0 Запор К59.1 Функциональная диарея К59.2 Неврогенная возбудимость кишечника, не классифицированная в других рубриках. Синдром раздраженного кишечника - с учетом его широкой распространенности в популяции (30-40%) - является в современной гастроэнтерологии предметом самого пристального внимания.

"Римские критерии II" функциональных расстройств кишечника (1999), предложенные Международной рабочей группой по изучению функциональных расстройств желудочно-кишечного трака, включают следующие рубрики: С. Функциональные кишечные расстройства С1. Синдром раздраженного кишечника С2. Функциональный метеоризм С3. Функциональные запоры С4. Функциональная диарея

Действительные нарушения качественного и количественного состава микрофлоры кишечника, в частности повышение содержания бактерий в тонкой кишке с нормальных 104/мл (тощая кишка) до 106/мл и выше, именуются в современной гастроэнтерологии синдромом избыточного роста бактерий (bacterial overgrowth syndrome). Этот синдром развивается в силу строго определенных причин (например, резекция илеоцекального клапана с последующим забросом содержимого толстой кишки в тонкую, резекция кишки с наложением анастомозов бок в бок, желудочно-толстокишечные или тонко-толстокишечные свищи, стриктуры кишечника при болезни Крона, радиационном энтерите, бесконтрольном приеме антибиотиков и т.д.), и при состояниях, при которых содержимое толстой кишки поступает в тонкую или же нарушается пропульсивная моторика тонкой кишки. Синдром избыточного роста бактерий имеет достаточно четко выраженную клинику -  это диарея с возможными проявлениями нарушения всасывания. Синдром избыточного бактериального роста диагностируется на основании результатов дыхательного теста с Н2, проводимого с лактулозой, а также результатов бактериологического исследования посева дуоденального аспирата кишечника с подсчетом содержания микроорганизмов. Лечение синдрома избыточного роста бактерий предполагает в первую очередь воздействие на основное заболевание, послужившее причиной его развития. Поняв суть и причину нарушения флоры и найдя источник кишечных расстройств отнюдь не в дисбактериозе, как всего лишь симптоме болезни, врач сможет действительно помочь пациенту с кишечным расстройством.

Все логические построения, посвященные дисбактериозу, базируются на фундаменте трудоемкого и дорогостоящего исследования, которое выполняют теперь во многих лабораториях. Однако, чаще всего суть этих исследований заключается в том, что результаты изучения нескольких видов бактерий в кусочке кала механически экстраполируются на сложнейшую кишечную микроэкологическую систему, представленную многочисленными штаммами более чем 400 видов микроорганизмов. При этом изменению бактериального спектра, к сожалению, отводится роль не следствия, а причины различных системных внекишечных расстройств. Это, если все равно , что говорить, что жар  является причиной гриппа. Пациенты часто обращаются с просьбой дать трактовку тому или иному анализу на дисбактериоз, но сделать это корректно без углубленного обследования  невозможно.

Дело в том, что так называемые "нормальные показатели" усреднены и сделаны эмпирическим путем. Не удается найти действительно серьезных работ, в которых бы были глубоко исследованы микрофлора фекалий и влияние на нее возраста, пола, беременности, принимаемой пищи и лекарств, текущих болезней, а также темпы возвращения к исходным показателям после прекращения действия временных и  чаще всего устранимых факторов.

Почему иногда легче поставить диагноз дисбактериоз? Может быть ответ на этот вопрос в том, что существует преграда на пути к истине в виде определенных причин, таких как например

  • Техническая невозможность или нежелание искать первопричину нарушений микроэкологии кишечника.
  • Гиподиагностика синдрома нарушенного кишечного всасывания, некоторых ферментопатий , среди которых широко распространена лактазная недостаточность и таких болезней как целиакия, муковисцидоз, панкреатическая недостаточность. Напомним так же, что и глистная инвазия , например, лямблиоз является одной из наиболее распространенных причин мальабсорбции в детском возрасте.
  • Нарушение вскармливания ребенка первого года жизни. Неправильное введение прикорма, искусственное вскармливание.
  • Инфицирование ребенка патогенными микроорганизмами через материнское молоко или лактационные энтероколиты.
  • Иммунодефицитные состояния пациента. Упорный дисбактериоз – один из наиболее частых маркеров первичных и вторичных иммунодефицитов
  • Функциональные заболевания желудочно-кишечного тракта, синдром раздраженного кишечника
  • Нерациональное применение лекарственных средств, в особенности необоснованное применение антибиотиков широкого спектра действия длительно, несколькими курсами и без основательного на то права. 

Подчеркнем, что дисбактериоз в большинстве случаев только симптом основного заболевания, который, как правило, исчезает после проведения соответствующего этиотропного лечения.   

Что нужно знать о дисбактериозе кишечника:

1. Главное – дисбактериоза, как диагноза не существует! Нет такого заболевания, которое могло бы иметь отношение к понятию дисбактериоз, нет необходимости искать и лечить дисбактериоз кишечника.
2. Просвет кишечной трубки у родившегося ребенка практически стерилен. В течение короткого времени кишечник колонизируется микроорганизмами, которые живут в нем всю жизнь человека.
3. Эти микроорганизмы могут быть полезными, принимающими участие в процессе пищеварения или нейтральными как сапрофиты и даже вредными, вызывающими кишечные заболевания.
4. Количество микроорганизмов в кишечнике, а также их соотношение у каждого человека разное и зависит от бесчисленного множества факторов – от тогов скаких условиях живет человек, что он кушает, насколько тщательно соблюдает правила гигиены, здоров он или болен в данный момент. Нет четких и  единых норм содержания микробов в просвете кишечника. Это первое что нужно понять. Человек имеет право на индивидуальную микрофлору.
5. Отсутствие норм, масштабных исследований в этом направлении связано, в первую очередь с тем, что исследования такие не нужны клинической медицине и не несут никакой смысловой нагрузки! От количества и состава микробных колоний мало чего зависит. И это второй вывод нашей беседы.
6. Далее, следует различать содержание микроорганизмов в каловых массах и в просвете кишечника , которые так активно исследуют иные доктора и содержание их же собственно в кишечнике, т.е. на кишечной стенке - там, где они могут иметь хоть какое-то гипотетическое значение. Нет никаких убедительных данных, что количество МО в кале хоть каким-то образом соответствует соотношению их в кишке. Таким образом, что мы определяем абсолютно непонятно. 
7. Вы спросите, а как же вредные бактерии? Их что тоже не нужно определять? Нужно! Вот их всенепременно нужно определить в случае развития кишечной инфекции. При холере, сальмонеллезе, дизентерии, стафиллококке патогенном и других заболеваниях, мы ищем в кале возбудителя, определяем его и исследуем, к каким препаратам он чувствителен. Но только при болезни.

Диагноз дисбактериоз.

Почему все и всюду ставят диагноз дисбактериоз. А вот на этот вопрос ответа однозначного нет. Отчасти может быть потому, что проще всего поставить и лечить загадочный диагноз дисбактериоз, чем искать его истинную причину. Отчасти потому, что прочитать рекламную брошюрку очередных производителей для некоторых коллег легче, чем серьезный учебник (он же еще и денег стоит, да и написан чаще на английском)... В некоторых случаях потому, что проще списать непонятные симптомы на некую мифическую, но общеизвестную проблему дисбактериоза, хотя это не исключает существования множества заболеваний желудочно-кишечного тракта, каждое из которых имеет свою клинику, свой набор анализов и свое лечение. Но это болезни. Здоровых детей лечить не надо. В медицине принято лечить болезнь, а не анализ.

Степень заблуждения в вопросе о дисбактериозе кишечника дошла до того, что помимо биологических добавок для лечения дисбактериоза нам предлагают покупать даже продукты!!! «Покупайте у нас постоянно и у Вас не будет дисбактериоза!!!». Мы надеемся, что прочитав эти слова, Вы всегда будете скептически относиться к подобной рекламе, насколько бы убедительна она не была. Под проблемой с кишечником надо искать причину, надо поставить диагноз, а не успокаиваться на обнаружении только симптома  болезни и  замещать диагноз симптомом.

А как же антибиотики? Почему же тогда при их приеме нередко «расстраивается желудок»

Рутинной ошибкой, впрочем, и распространенным добросовестным заблуждением является мнение, что при назначении антибиотиков обязательно происходит нарушение микробного равновесия в толстом кишечнике. А вот интересно, кстати, почему никто не додумался восстановить равновесие флоры, например в легких или в носоглотке? Какой бизнес пропадает! Ингаляционный йогурт, обогащенный натуральным мусором с альпийских полей!!!. Увы производителям. Как правило, и в большинстве случаев, применение антибиотиков строго по показаниям не влечет за собой каких-либо серьезных расстройств и не требует дополнительной коррекции микробного баланса. Другое дело бесконтрольная антибиотикотерапия без четких на то оснований.

Для ряда антибактериальных препаратов, временная диарея является побочным эффектом применения. Например, популярный антибиотик амоксиклав вызывает диарею примерно в 7-10% случаев, так как содержит клавулановую кислоту, которая усиливает перистальтику кишечника. Таким образом, временное учащение и разжижение стула надо рассматривать не как самостоятельную проблему, требующую коррекции, а как одно из действий препарата. Но повторюсь, что только при соблюдении строгих показаний и правил приема антибиотика сам антибиотик вреда не принесет. Лечить вирусную инфекцию антибиотиком или давать антибиотик для профилактики якобы возможной пневмонии или отита- вот это вредно. Каков диагноз- таково и должно быть лечение. Антибиотики врач должен назначать только по строгим показаниям и имея обоснованный довод необходимости антибиотикотерапии.

Пробиотики и пребиотики  - что это?

Термины пробиотики и пребиотики появились с возможностью выделения чистых культур кишечной микрофлоры и синтезирования или выделения из продуктов веществ, необходимых для нормальной жизнедеятельности этой кишечной микрофлоры. Так стали называть группу препаратов, созданных человеком.

И те и другие не являются лекарствами и относятся к БАД ( биологически активные добавки).

Пробиотики – это живые микроорганизмы кишечника.

Колонии микроорганизмов кишечника каждого индивидуума строго индивидуальны. Кишечная микрофлора при рождении заселяется в организме и ведет активную борьбу за свое место в кишечнике на протяжении всей жизни индивидуума. Кишечная флора играет важную роль в переваривания пищи, всасывании важных веществ и микроэлементов в кишечнике, в поддержании иммунитета. Пробиотики в виде пищевых добавок, такие, как например лактобактерии, бифидобактерии , попадая в организм могут только лишь стимулировать рост уже имеющейся флоры индивидуума, являясь «конкурентом за место в кишечнике». Но вряд ли они способны заселить или вытеснить собою какую- либо флору, находящуюся в конкретном кишечнике.

Пребиотики- это вещества, которые питают и стимулируют жизнедеятельность живых микроорганизмов кишечника. Например, олигофруктоза, инулин, лактулоза, олигосахариды грудного молока. Эти вещества присутствуют во многих пищевых продуктах и могут создаваться синтетическим путем.  Олигофруктоза  содержится в бананах, пшенице, в меде.  Лактулоза является синтетическим дисахаридом. Ферментация пребиотиков в кишечнике способствует росту нормальной микрофлоры кишечника.

Синбиотики- это БАД, содержащие и пробиотик и пребиотик в одном флаконе.

Применять пробиотики, пребиотики, синбиотики или антибиотики лучше все таки по назначению квалифицированного врача.

Так как же поддержать организм ребенка? Какие действия предпринять? Может среди множества товаров, которые нам предлагают есть что-то действительно полезное? Что бы в кишечнике моего ребенка жили только полезные микробы?

Ничего, абсолютно ничего сверхординарного делать не надо. Поддерживайте грудное вскармливание детям до года. Кормите детей правильно, вкусно и разнообразно. Приучите их мыть фрукты, овощи и руки перед едой. Обучите элементарным правилам личной гигиены и не занимайтесь без нужды самолечением.

 Автор статьи врач Мартышов В.А.

Ятрогенный дисбиоз кишечника у гастроэнтерологических больных | Сереброва С.Ю.

Сегодня на фоне неуклонного роста заболеваемости различными болезнями желудочно–кишечного тракта, изменяющейся экологии, применения новых технологий в пищевой промышленности, расширения показаний к применению антибактериальной терапии уровень обсуждения проблемы изменений микробиоценоза кишечника представляется недостаточным. Между тем количественный и качественный состав микробных ассоциаций подвергается существенным изменениям под действием огромного количества внешних и внутренних факторов. Каковы последствия нарушений динамического равновесия симбиотической микрофлоры?

Сегодня на фоне неуклонного роста заболеваемости различными болезнями желудочно–кишечного тракта, изменяющейся экологии, применения новых технологий в пищевой промышленности, расширения показаний к применению антибактериальной терапии уровень обсуждения проблемы изменений микробиоценоза кишечника представляется недостаточным. Между тем количественный и качественный состав микробных ассоциаций подвергается существенным изменениям под действием огромного количества внешних и внутренних факторов. Каковы последствия нарушений динамического равновесия симбиотической микрофлоры?
Известно, что количество кишечных микроорганизмов на порядок превышает число собственных клеток организма хозяина, что дает повод утверждать, что это – особая, весьма сложная и еще недостаточно изученная система [16,4].
Распределение микроорганизмов в желудочно–кишечном тракте неравномерно: каждому отделу свойственен свой, относительно постоянный состав микробных ассоциаций. В желудке и проксимальных отделах тонкой кишки микроорганизмов содержится относительно мало, чему способствуют бактерицидные свойства слюны и особенно соляной кислоты желудка. Тем не менее в желудке присутствуют устойчивые в кислой среде стафилококки, стрептококки, молочнокислые бактерии, грибы. В норме доминируют стрептококки и лактобактерии при отсутствии облигатно–анаэробных бактерий и энтеробактерий. В последние десятилетия активно обсуждаются проблемы персистирования на слизистой оболочке антрального отдела желудка Helicobacter pylori, принимающего участие в патогенезе ряда серьезных гастроэнтерологических заболеваний.
В проксимальных отделах тонкой кишки микроорганизмов еще меньше, чему, кроме барьерной функции кислой среды желудочного содержимого, способствуют бактерицидные свойства желчи, микробный антагонизм ацидофильной флоры илеоцекального отдела к бактериям толстого кишечника. При патологических состояниях, связанных со снижением кислотопродукции в желудке (ахлоргидрия, гипоацидный и анацидный гастриты, состояние после резекции желудка и т.д.), наблюдается заселение различными микроорганизмами проксимальных отделов тонкого кишечника.
В дистальных отделах тонкой кишки увеличивается бактериальная плотность микрофлоры, причем пристеночная микрофлора превалирует над внутрипросветной, а количество аэробных и анаэробных бактерий становится равным. Существенно количество широко распространенных в окружающей среде актиномицет и близких к ним микроорганизмов, роль которых в продукции витаминов и веществ, обеспечивающих колонизационную резистентность, весьма значительна [15].
Наиболее богата микрофлора толстая кишка: 30% от сухой массы фекалий составляют микроорганизмы. Состав микрофлоры толстого кишечника исключительно разнообразен [1,5]. Известно приблизительно 500 видов микроорганизмов, его населяющих. Однако представления о микроэкологическом благополучии обычно строятся на основе изучения нескольких наиболее распространенных представителей микрофлоры. Анаэробами являются бифидобактерии, лактобациллы, бактероиды, вейонеллы, пептострептококки, клостридии. Аэробы представлены кишечной палочкой, лактозонегативными энтеробактериями (протей, энтеробактер, цитробактер и т.д.), энтерококками, стафилококками, дрожжеподобными грибами. Количество бактериальных клеток к нижележащим отделам увеличивается, внутрипросветная флора начинает доминировать над пристеночной [7]. Состав микробных популяций в разных биотопах ЖКТ различен, но все компоненты экосистемы находятся в состоянии симбиоза, поддерживая в ней динамическое равновесие (табл. 1).
Качественные или количественные нарушения нормальной микрофлоры в зарубежной литературе обозначаются как микроэкологические нарушения. В нашей стране их принято называть дисбактериозом. Хотя этот термин не очень удачен, адекватного аналога ему пока не найдено. Для российских клиницистов он традиционен и понятен, ассоциируясь именно с микроэкологическими нарушениями разных биотопов. Поэтому в отраслевом стандарте по микробной экологии желудочно–кишечного тракта сохранен термин «дисбактериоз», как исторически сложившийся, хотя и спорный [4]. Дисбиоз (дисбактериоз) кишечника – это не только количественное и качественное изменение кишечной микрофлоры. Согласно отраслевому стандарту под дисбактериозом кишечника понимают клинико–лабораторный синдром, возникающий при ряде заболеваний и клинических ситуаций и характеризующийся:
• симптомами поражения кишечника;
• изменением качественного и/или количественного состава нормальной микрофлоры;
• транслокацией различных микроорганизмов в несвойственные биотопы;
• избыточным ростом микрофлоры.
В настоящее время как в зарубежной, так и в отечественной литературе широко употребляется термин «синдром избыточного бактериального роста» (bacterial overgrow syndrome) по отношению к тонкой кишке. Следует отметить, что он не является полным аналогом понятия «дисбактериоз». Термин обозначает один из его вариантов – транслокацию условно–патогенной микрофлоры в тонкую кишку из других биотопов с последующим ее ростом и развитием и повышением содержания бактерий в тонкой кишке с 104/мл (тощая кишка) до 106/мл и выше [4].
Дисбиоз кишечника всегда является вторичным состоянием и, следовательно, требуется поиск первопричины. Ведущая роль в его формировании принадлежит нарушению популяционного уровня бифидо– и лактобактерий. При развитии микроэкологических и иммунных нарушений в организме селективное преимущество приобретают условно–патогенные микробы, среди которых обнаруживаются клоны, несущие гены лекарственной устойчивости и генетические детерминанты так называемых «островов» патогенности, ассоциированные с адгезивными, цитотоксическими и энтеротоксическими свойствами бактерий [5]. Продукты метаболизма условно–патогенной микрофлоры (индол, скатол, сероводород и др.) и токсины снижают детоксикационную способность печени, усугубляют симптомы интоксикации, подавляют регенерацию слизистой оболочки, способствуют образованию опухолей, угнетают перистальтику и обусловливают развитие диспепсического синдрома. Воздействие бактериальных токсинов приводит к увеличению проницаемости слизистого барьера и повреждению эпителия слизистой оболочки кишечника [9]. Проникшие через поврежденные мембраны энтероцитов макромолекулы нерасщепленных белков и сахаров являются причиной аллергических реакций и пищевой непереносимости.
Наблюдаемое в настоящее время увеличение частоты и тяжести острых инфекционных заболеваний, торпидное течение и хронизация воспалительного процесса объясняются некоторыми исследователями сопутствующим дисбактериозом [4].
Значительные качественные и количественные изменения в составе нормальной микрофлоры могут быть вызваны действием различных стрессовых факторов, широким и бесконтрольным применением антибактериальных препаратов, лучевой и гормональной терапией, гнойно–воспалительными процессами и т.д. [4,13]. Существуют и другие факторы, способствующие избыточному росту микрофлоры в тонкой кишке: применение препаратов, блокирующих кислотопродукцию в желудке, атрофический гастрит, дивертикулиты тонкой кишки, кишечная непроходимость, нарушения моторики кишки и т.д. [8].
Развитие собственно кишечных симптомов, ассоциированных с микроэкологическими изменениями в толстой кишке и/или избыточным бактериальным ростом в тонкой кишке, не всегда коррелирует со степенью микробных нарушений и зависит от компенсаторных возможностей организма. Нарушение микробной экологии на уровне только толстой кишки может не иметь никаких клинических проявлений, в то же время повышение содержания бактерий в тонкой кишке до 106/мл и выше имеет четко выраженную клиническую составляющую – диарею с возможным развитием мальабсорбции [4].
Одной из основных причин развития дисбиоза кишечника сегодня справедливо называют антибиотикотерапию, которая широко используется при лечении множества гастроэнтерологических заболеваний.
По своей распространенности, клинической и социальной значимости язвенная болезнь желудка и двенадцатиперстной кишки в настоящее время занимает лидирующие позиции в плане изучения этиологии, патогенеза и возможностей терапевтического и хирургического подходов к лечению. В последние десятилетия активно обсуждается роль инфекционного фактора в развитии данного заболевания, а антихеликобактерная терапия является основным стандартом лечения хеликобактер–ассоциированных кислотозависимых состояний, что отражено в международных соглашениях (Маастрихтские соглашения 1–3, соответственно 1996, 2000 и 2005 годы) [12]. Хорошо известно, что состав мукозной микрофлоры гастродуоденальной зоны не ограничивается только хеликобактериями, а включает в себя еще до 12–14 различных видов микроорганизмов [20]. При обострении хронического гастрита и рецидиве язвенной болезни из биоптатов слизистой оболочки высевается до 22 видов различных микроорганизмов, обладающих выраженной ферментативной и цитотоксической активностью, что укладывается в избыточный рост мукозной флоры, способствующей развитию воспалительно–некротических и торможению репаративных процессов. Эти данные, конечно, свидетельствуют о необходимости ликвидации избыточного роста микрофлоры и восстановления нормального микробиоценоза гастродуоденальной зоны. Изучение чувствительности выделенных микроорганизмов к антибактериальным препаратам позволило показать, что ампициллин, амоксициллин, офлоксацин, кларитромицин, гентамицин подавляют рост 16–20 видов микроорганизмов и 100% штаммов H. рylori, а норфлоксацин, ципрофлоксацин, хлорамфеникол и тетрациклин – 17–20 видов и 71,4–76,2% H. рylori. Однако после проведенного курса антибактериальной терапии названными препаратами определяется требующий коррекции дефицит лактобактерий.
Тем не менее базисная терапия при язвенной болезни включает использование антисекреторного (ингибитора протонного насоса) и антибактериального (макролидов, полусинтетических пенициллинов, нитрофуранов) компонентов [12]. Некоторые схемы предполагают прием вместо антисекреторного средства висмутсодержащего препарата. Согласно итоговому документу Маастрихтского соглашения–2 язвенная болезнь, независимо от фазы заболевания, является основным показанием к антихеликобактерной терапии. Кроме того, такими показаниями назывались хронический антральный гастрит, атрофический гастрит, MALTома, состояние после резекции желудка по поводу рака. Эрадикация считалась необходимой у ближайших родственников больных раком желудка. Более того, проведение антихеликобактерной терапии допускалось по желанию пациента и при отсутствии клиники заболевания. Причем протоколом в принципе допускалось назначение эрадикационных схем без предварительного эндоскопического лечения. H. pylori–позитивным пациентам с функциональной диспепсией также рекомендовано проведение эрадикационной терапии, так как это приводит к длительному улучшению самочувствия и является профилактикой язвенной болезни [21].
Терапия первой линии, согласно этим протоколам, включает 7–дневное применение ингибиторов протонной помпы (или ранитидин висмут цитрата) в стандартной дозе 2 раза в сутки; кларитромицина 500 мг 2 раза в сутки и амоксициллина 1000 мг 2 раза в сутки или метронидазола 500 мг 2 раза в сутки. При отсутствии эрадикации рекомендовано назначение терапии второй линии: ингибиторы протонной помпы в стандартной дозе 2 раза в сутки + висмута субсалицилат/субцитрат 120 мг 4 раза в сутки + метронидазол 500 мг 3 раза в сутки + тетрациклин 500 мг 4 раза в сутки. В 2005 году были разработаны дальнейшие рекомендации по лечению H. pylori–ассоциированной патологии желудочно–кишечного тракта, получившие название «Маастрихт–3». Они предполагают увеличение длительности антихеликобактерной терапии до 14 дней, расширение показаний к проведению эрадикации (длительный прием нестероидных противовоспалительных препаратов (НПВП), ингибиторов протонной помпы (ИПП) при гастроэзофагеальной рефлюксной болезни (ГЭРБ), квадротерапия в качестве схемы первой линии может назначаться при наличии в данном регионе резистентных к кларитромицину штаммов H. pylori более 10% и к метронидазолу более 40%. Одновременное применение двух и более антибактериальных препаратов не может не оказывать влияния на микробиоценоз кишечника, особенно если он исходно нарушен (что наблюдается у подавляющего большинства больных). Учитывая это, схемы антихеликобактерной терапии при лечении данной патологии необходимо подбирать таким образом, чтобы, помимо достижения необходимого уровня эрадикации H. рylori, антибактериальные препараты, входящие в их состав, были активны и в отношении условнопатогенной микрофлоры [24,26].
Антибиотикорезистентность является одной из наиболее важных проблем, возникающих при применении антибактериальных препаратов. Ее развитие наблюдается не только у микроорганизмов, на которые направлено действие препарата, но и у представителей сапрофитной микрофлоры. Показано, что применение наиболее распространенной комбинации препаратов для эрадикации H. pylori (кларитромицин, метронидазол и омепразол) способствует появлению высокорезистентных, персистирующих не менее 3 лет, штаммов энтерококков [31]. В исследовании [26], где проводилась 7–дневная эрадикационная терапия с применением 1 г амоксициллина или 250 мг кларитромицина (доза, в 2 раза меньше рекомендуемой), 20 мг омепразола и 400 мг метронидазола 2 раза в сутки, изучался состав микрофлоры до и после эрадикационной терапии. В обоих случаях были выявлены значительные изменения нормальной микрофлоры: обнаруживался резистентный к антибиотикам стрептококк, в группе, где пациенты принимали амоксициллин, выявлен избыточный рост и колонизация желудка резистентными энтеробактериями с повышенной продукцией b–лактамаз. В целом была отмечена выраженная супрессия анаэробной микрофлоры. При применении кларитромицина выявлены кларитромицин–резистентные бактероиды. Было обнаружено, что эрадикационная схема, включающая кларитромицин, хотя и эффективнее, но обладает более выраженным подавляющим действием в отношении нормальной микрофлоры.
Известно, что при приеме антисекреторных препаратов (блокаторов Н2–гистаминовых рецепторов и ингибиторов протонной помпы) устраняется барьерная функция кислого желудочного содержимого для патогенной микрофлоры [8,19,27]. На фоне применения омепразола наблюдается избыточный рост в тонкой кишке Escherichia coli, Candida albicans, Enterococcus, Lactobacillus bifidus, Bacteroides vilgatus, Bacteroides uniformis, Eubacterium lentum, Eubacterium parvum, Corynebacterium granulosum [19,34]. Возникновение острых эрозивно–язвенных поражений желудка и двенадцатиперстной кишки, кроме язвенной болезни, может быть связано с рядом стрессовых факторов и заболеваний: травмой, ожогами, обширным хирургическим вмешательством, сепсисом, сердечной, легочной, печеночной, почечной недостаточностью. Применение НПВП, кортикостероидов, дигиталиса и др. также может вызвать повреждение слизистых оболочек гастродуоденального тракта, при этом лечебная тактика практически всегда будет основана на подавлении кислотной продукции.
Другой частой причиной (порой безосновательной) для назначения антибактериальных препаратов являются острые кишечные инфекции (ОКИ). Из–за незнания особенностей патогенеза и клиники заболеваний, относящихся к этой довольно большой группе, имеют место многочисленные случаи бесконтрольного применения антибиотиков, особенно при лечении сальмонеллеза и пищевых токсикоинфекций. При этом чаще применяются антибиотики широкого спектра действия. Часто при нетяжелых формах заболевания наблюдаются случаи самолечения. Однако хорошо известно, что у больных, перенесших острую кишечную инфекцию, клиническое выздоровление может не означать завершение патологического процесса в слизистой оболочке. Более чем у 30% больных развиваются хронические заболевания кишечника, наблюдается рост числа затяжных и хронических форм инфекций, повышается вероятность развития дисбиоза кишечника [14]. Некоторые авторы считают, что применение антибиотиков целесообразно лишь при генерализованной форме сальмонеллеза и при нозокомиальном сальмонеллезе [18,25]. В других случаях сальмонеллеза, а также при неосложненном течении ОКИ нешигеллезной и нехолерной этиологии антибиотики не показаны.
Иерсиниоз – острое инфекционное заболевание с первичным поражением кишечника и наклонностью к генерализованному течению и системным проявлениям [17]. Иерсиниозный илеит представляет собой значительную проблему для диагностики. Илеоцекальный отдел место формирования патологического процесса при целом ряде воспалительных болезней кишечника. Диагноз иерсиниозного илеита устанавливают на основании клинической картины (боли в правой подвздошной области, понос, повышение температуры тела), морфологических изменений (воспаление слизистой оболочки кишечника и узловой лимфоидной гиперплазии), бактериологического или серологического подтверждения иерсиниозной инфекции. Таким образом, жалобы больных неспецифичны, постановка диагноза требует применения специальных методов исследования. Поэтому больные с иерсиниозным илеитом часто являются пациентами терапевтических отделений, этим больным предварительно проводятся курсы соответственно нерациональной антибиотикотерапии, а правильный диагноз часто устанавливается при лишь затяжном и хроническом течении.
Дисбиоз закономерно развивается при состояниях, сопровождающихся хронической диареей [3]. Она является следствием значительного количества заболеваний органов желудочно–кишечного тракта (болезнь Менетрие, Крона, Уиппла, язвенный колит, лучевой колит, лимфома кишечника, абдоминальная форма лимфогранулематоза, кишечные инфекции), наследственных ферментопатий. В развитии хронической диареи следует отметить также роль ишемического и радиационного энтеритов, паразитарных инвазий, ятрогенных (лекарственных) энтеритов после применения антибактериальных и слабительных средств, нестероидных противовоспалительных препаратов [3,9]. Упорная диарея, возникшая при применении ингибиторов протонной помпы, может быть связана с развитием колита (лимфоцитарного и коллагенозного) [19].
Длительный прием слабительных средств (препаратов сенны, коры крушины, ревеня, бисакодила, оксифенизатина) повреждает межклеточные соединения и клеточные мембраны, увеличивает проницаемость слизистой оболочки, десквамацию эпителия. Следствием этого является диарея с дегидратацией, гипокалиемией, гипонатриемией, синдромом мальабсорбции. Описаны необратимые изменения различных отделов слизистой оболочки кишечника [9].
НПВП (индометацин, диклофенак, ибупрофен, пироксикам), глюкокортикостероиды снижают протективные свойства пристеночной слизи кишечника, способствуя потере белка, образованию язв, возникновению перфораций и кровотечений [9]. Это имеет особое значение при наличии у пациента сочетанной патологии. Например, частота развития язвенной болезни двенадцатиперстной кишки, требующей назначения антибиотикотерапии, при бронхиальной астме, по мнению некоторых авторов, составляет 25,4% [21].
Тяжелой, нерешенной проблемой являются неспецифический язвенный колит и болезнь Крона, в том числе в плане развития дисбиоза кишечника как следствия течения воспалительного процесса, так и проявления нежелательных эффектов лекарственных средств. Известно негативное влияние глюкокортикостероидов на нормальную микрофлору кишечника. Некоторыми исследователями [30] показано, что на фоне приема сульфасалазина наблюдаются серьезные изменения фекальной микрофлоры с сокращением количества Escherichia coli и Bacteroides. Эффект сульфасалазина на микрофлору тонкой кишки описан как незначительный.
Диарея, ассоциированная с применением антибиотиков, причиной которой является дисбиоз кишечника, развивается у 2,6 – 26% пациентов, получавших клиндамицин, линкомицин, ампициллин, рифампицин и цефалоспорины [29]. Причиной такой диареи являются микроорганизмы, способные усиливать секрецию ионов и воды или повреждать стенку кишки. При этом морфологические изменения в слизистой оболочке кишечника чаще всего отсутствуют. В более тяжелых случаях выявляют три типа изменений: 1) катаральное воспаление (отек и гиперемия) слизистой оболочки; 2) эрозивно–геморрагическое поражение; 3) псевдомембранозное поражение. Применение антибиотиков широкого спектра действия способствует избыточному росту клостридий, вырабатывающих энтеротоксины А и В. Они вызывают отек слизистой оболочки кишки и изъязвление – псевдомембранозный энтероколит с тяжелыми проявлениями: диареей, иногда кровотечением, интоксикацией, высокой температурой тела, лейкоцитозом [9].
Эндоскопическая картина псевдомембранозного колита характеризуется отеком слизистой оболочки, наличием преимущественно в дистальных отделах ободочной и прямой кишок спаянных со слизистой оболочкой «мембран» (бляшковидных, лентовидных и сплошных). При гистологическом исследовании обнаруживают субэпителиальный отек с круглоклеточной инфильтрацией собственной пластинки, капиллярные стазы. При образовании псевдомембран видны экссудативные инфильтраты, «сепарирующие» эпителий от подлежащих тканей. Эпителий местами отсутствует. Протяженность поражения может быть различной.
Кандидоз слизистых оболочек органов пищеварения – яркий пример оппортунистической инфекции, «иммунологическая драма» [22]. В связи с большой распространенностью в природе грибов рода Candida транзиторное носительство значительно распространено. Candida spp. не представляют серьезной угрозы здоровью иммунокомпетентного человека, однако при нарушениях в системе антимикробной защиты наблюдается значительный рост заболеваемости кандидозом. Candida spp. способны к адгезии и инвазии с последующим цитолизом ткани, а затем к лимфогематогенной диссеминации. Из факторов агрессии и патогенности микроорганизмов у кандид обнаруживают ферментные (плазмокоагулазы), неферментные белки (эндотоксин), полисахариды, глюкоконьюгаты, свободные липиды. Candida spp. способны к инвазии слизистых оболочек, представленных, в первую очередь, плоским эпителием, реже – однослойным цилиндрическим. Парадокс заключается в сложности для Candida spp. инвазировать цилиндрический эпителий, хотя он однослойный, поэтому инвазивный микотический процесс, часто наблюдаемый в полости рта, пищевода, гораздо реже наблюдается в желудке и кишечнике. Инвазия связана с трансформацией гриба рода Candida в нитчатую (псевдомицелий) форму. При отсутствии подобных изменений говорят о кандидоносительстве.
При неинвазивной форме кандидоза происходит контакт поверхностных, корпускулярных антигенов, первичных метаболитов гриба с иммунокомпетентными клетками с образованием повышенного количества IgE и сенсибилизированных лимфоцитов. Это может привести к развитию бронхиальной астмы, атопического дерматита, крапивницы. При резорбции в кишечнике продуктов метаболизма гриба его плазмокоагулаза, протеазы, липофосфорилазы, гемолизин и эндотоксины могут вызвать специфическую интоксикацию и вторичный иммунодефицит. Наконец, за счет взаимодействия с нормальной и условно–патогенной микрофлорой Candida spp. могут индуцировать дисбиоз и микст–инфекцию слизистых оболочек.
Выделяют 3 формы кандидоза кишечника:
– инвазивный,
– фокальный,
– неинвазивный (кандидозный дисбиоз).
Иногда язвенная болезнь двенадцатиперстной кишки и неспецифический язвенный колит могут осложняться кандидозом. При этом инвазия псевдомицелия Candida spp. происходит исключительно в участках кишечника, деэпителизированных вследствие основного заболевания (фокальный кандидоз). Во врачебной практике чаще встречается дисбиоз кишечника с избыточным ростом Candida spp.
Следует обратить внимание на проблему перианального кандидодерматита. Так как основной жалобой при данной патологии является рецидивирующий анальный зуд, обычно пациенты обращаются именно к гастроэнтерологу.
Часто кандидоз органов пищеварения протекает в виде микст–инфекции: Candida–бактериальной, Candida–герпетической, Candida–протозойной, что делает клиническую картину заболевания довольно вариабельной.
В настоящее время коррекция нарушенного микробиоценоза кишечника состоит из 3 этапов:
– селективная деконтаминация;
– заместительная терапия;
– стимуляция роста нормальной микрофлоры.
Санация кишечника от условно–патогеной микрофлоры с помощью антибиотиков (основных виновников подавления нормальной микрофлоры) должна применяться при дисбиозе кишечника для подавления избыточного бактериального роста микрофлоры по абсолютным и относительными показаниями. Абсолютными показаниями к назначению антибиотиков являются бактериемия и угроза энтерогенного сепсиса. Применяют антибиотики широкого спектра действия. Относительные показания к применению антибиотиков: хронические диарейные заболевания с избыточным бактериальным ростом патогенной микрофлоры в тонкой кишке (пострезекционный синдром, спаечная болезнь, общая вариабельная гипогаммаглобулинемия, целиакия с торпидным течением и др.). Лечение следует начинать с применения кишечных антисептиков, которые в меньшей степени подавляют рост симбиотной микробиоты. При дисбиозе толстой кишки антибактериальные препараты не показаны. В любом случае коррекцию дисбиоза следует проводить на фоне патогенетической терапии заболевания, ставшего причиной дисбиоза.
Селективная деконтаминация принципиально направлена на уничтожение патогенной и условнопатогенной флоры и защиту организма хозяина от заражения экзогенными бактериями. С этой целью применяются средства, обладающие селективной антибактериальной активностью: специфические бактериофаги (стафилококковый бактериофаг, коли–протейный бактериофаг, пиобактериофаг поливалентный, бактериофаг клебсиелл поливалентный), пробиотики, содержащие активные антагонисты патогенной и условнопатогенной микрофлоры [6, 23].
Для коррекции дисбиозов кишечника применяют препараты на основе микроорганизмов – представителей нормальной микрофлоры человека, так называемых эубиотиков (пробиотиков). Популярными стали пробиотики, изготовленные на основе бифидобактерий и лактобактерий (бифидумбактерин–форте, бифиформ, бифилиз, бификол, аципол, линекс, биомасса ацидофильных лактобактерий «Наринэ» ацилакт) (табл. 2). Эти препараты содержат культуры живых микроорганизмов, способных восстанавливать нормальный микробиоценоз, угнетать патогенные и условнопатогенные микроорганизмы и создавать благоприятные условия для развития нормальной микрофлоры. В присутствии пробиотиков происходит индукция антител (IgA), активизация фагоцитарной функции лейкоцитов. Важным преимуществом таких биопрепаратов является то, что микроорганизмы, входящие в их состав, непатогенны и нетоксичны. Состав микроорганизмов, входящих в препараты пробиотиков, может быть различным.
Живые бифидобактерии практически не достигают толстой кишки. Уже в желудке большая их часть погибает из–за высокой кислотности. Преодолевшая кислотный барьер часть микроорганизмов подвергается воздействию щелочной среды в двенадцатиперстной кишке, из–за чего может повреждаться их оболочка, утрачивается способность к адгезии.
Лактобациллы более устойчивы в кислой среде. Антибактериальная активность их связана с продукцией молочной кислоты, спирта и лизоцима, веществ, обладающих антибиотической активностью, интерферонов, интерлейкина–1 и др. Для приготовления первого препарата, содержащего лактобактерии – лактобактерина применяли микробную массу живых L. plantarum, лиофильно высушенную в защитной сахаро–желатино–молочной среде. Аципол, изготавливаемый на основе микробной массы живых L. аcidophilus, обладает высокой антагонистической активностью в отношении широкого спектра патогенных и условнопатогенных микрооргаизмов. В отличие от лактобактерий вида плантарум используемые для приготовления Аципола ацидофильные лактобактерии являются облигатными для человека микроорганизмами; они выделяют ферменты, витамины, способствуют пищеварению и, улучшая обмен веществ, обладают иммуномодулирующим действием, нормализуя естественную резистентность организма. Основаниями для выбора L. аcidophilus для производства Аципола стали их активная кислотопродукция, выраженная способность к адгезии и, следовательно, к длительному персистированию в кишечнике, устойчивость к действию соляной кислоты и пищеварительных ферментов. L. аcidophilus обладают относительно высокой резистентностью к антибактериальным препаратам.
Для селективной стимуляции роста нормальной микрофлоры кишечника используют пребиотики – вещества, стимулирующие рост и развитие микроорганизмов нормофлоры кишечника. Полисахариды различного происхождения (пектины, пуллулан, декстрин, инулин, хитозан и др.) могут использоваться в качестве пребиотических соединений. В качестве такого пребиотического компонента в состав Аципола входит полисахарид кефирных грибов.
Аципол применяется для лечения и профилактики дисбиоза кишечника при патологических состояниях, его вызывающих. Аципол используют также для коррекции ятрогенных повреждений состава нормальной микрофлоры. Следует отметить, что назначение Аципола, в который входят L. аcidophilus, обладающие высокой кислотообразующей активностью, будет оправданным у больных со сниженной желудочной кислотопродукцией и с нарушением моторной функции кишечника. Способность ацидофильных лактобактерий расщеплять лактозу может быть важным преимуществом при лечении пациентов с лактазной недостаточностью.
Препараты, создаваемые на основе бифидо– и лактобактерий, абсолютно безвредны для человека. Зафиксированные в последние два десятилетия единичные случаи заболеваний, вызванные лактобактериями (эндокардит) и бифидобактериями (менингит), отмечены только у больных с выраженным иммунодефицитом и относятся к редчайшей казуистике [35]. Таким образом, Аципол является эффективным и безопасным препаратом для лечения дисбиоза кишечника различного генеза.

Литература
1. Ардатская М.Д., Минушкин О.Н., Иконников Н.С. Дисбактериоз кишечника: понятие, диагностические подходы и пути коррекции. Возможности и преимущества биохимического исследования кала. Пособие для врачей. М., 2004.
2. Белобородова Н.В., Белдобородов С.М. Метаболиты анаэробных бактерий (летучие жирные кислоты) и реактивность макроорганизма. Антибиотики и химиотерапия. 2000; 2: 28–35
3. Белоусова Е.А., Златкина А.Р. Синдром диареи в практике гастроэнтеролога: патофизиология и дифференцированный подход к лечению. Фарматека. 2003; 10: 65–71.
4. Бондаренко В.М., Грачева Н.М. Пробиотики, пребиотики и синбиотики в терапии и профилактике кишечных дисбактериозов. Фарматека. 2003; 7: 56–63.
5. Бондаренко В.М., Грачева Н.М., Мацулевич Т.В. Дисбактериозы кишечника у взрослых. М., 2003. 224 с.
6. Воробьев А.А. и др. Дисбактериозы у детей. М.: КМК Лтд. 1998, 64 с.
7. Воробьев А. А., Несвижский Ю. В., Липницкий Е. М. и др. Исследование пристеночной микрофлоры желудочно–кишечного тракта у человека в норме и при патологии. Вестник РАМН. 2004; 2: 43–47.
8. Григорьев П.Ф., Яковенко А.В. Учебник для студентов медицинских вузов и врачей–курсантов учреждений постдипломного образования. М., 1998; 647 с.
9. Златкина А.Р. Фармакотерапия хронических болезней органов пищеварения. М.: Медицина, 1998, 287 с.
10. Ильина Н.О. и др. Метаболические критерии дисбактериоза кишечника при острых кишечных инфекциях у детей. Гастроэнтерология (Приложение к журналу Consilium Medicum). 2006; 1: 32–38
11. Красноголовец В.Н. Дисбактериоз кишечника и его клиническое значение. М., «Медицина», 1979. 191 с.
12. Маев И.В., Самсонов А.А. Современные стандарты лечения кислотозависимых заболеваний, ассоциированных с H.pylori (материалы консенсуса Маастрихт–3). Гастроэнтерология (Приложение к журналу Consilium Medicum). 2006; 1: 3–8.
13. Москалов Ю.И. Отдаленные последствия ионизирующих излучений. М.: Наука. 1995. 283 с.
14. Нозокомиальный сальмонеллез. Методические рекомендации М, 1998.
15. Осипов Г. А., Парфенов А. И., Верховцева Н. В. и др. Клиническое значение исследования микроорганизмов слизистой оболочки кишечника культурально биохимическим и хромато–масс–спектрометрическим методами. Экспер. и клинич. гастроэнтерология. 2004.
16. Парфенов А. И. Энтерология на рубеже ХХ и ХХI веков. Рос. журн. гастроэнтерол., гепатол., колопроктол. 2004; 3: 41–44.
17. Парфенов А.И., Чижикова М.Д. Иерсиниозный илеит затяжного и хронического течения. Терапевтический архив. 2002; 12: 77–80.
18. Руководство по инфекционным болезням (под ред. В.И Покровского), 996.
19. Хапаев Б.А., Журавлева М.В., Ребров В.Г. Нежелательные эффекты блокаторов протонной помпы и блокаторов Н2–гистаминовых рецепторов. Молекулярные механизмы нежелательных эффектов лекарственных средств. Монография. М.: Издательский дом «Русский врач». 2005 С. 249 – 293.
20. Чернин В.В., Червинец В.М. Пробиотики, антибактериальные и антифунгальные препараты как основа лечебно–реабилитационных мероприятий ликвидации дисбактериоза гастродуоденальной зоны при язвенной болезни и хроническом гастрите. Материалы научной программы II Международного конгресса «Восстановительная медицина и реабилитация», Москва, 20 – 21 сентября 2005 года.
21. Чернявская Г.М. и др. Особенности течения язвенной болезни двенадцатиперстной кишки при бронхиальной астме (клинические и патоморфологические аспекты). Терапевтический архив. 2004; 1: 58–62.
22. Шевяков М.А. Диагностика и лечение кандидоза кишечника. Терапевтический архив. 2003; 11: 77–79.
23. Шендеров Б.А. Медицинская микробная экология и функциональное питание. Т.1, 287 с.; Т2, 413с. М. 1998. Изд–во Грантъ.
24. Шептулин А.А. Синдром избыточного роста бактерий и «дисбактериоз кишечника»: их место в современной гастроэнтерологии. Рос. журн. гастроэнтерол., гепатол., колопроктол. 1999; 3: 51–54.
25. Ющук Н. Д., Бродов Л. Е. Острые кишечные инфекции, диагностика и лечение. – 2001.
26. Adamsson I. et al. Comparative effects of omeprazole, amoxycillin plus metronidazole versus omeprazole, clarithromycin plus metronidazole on the oral, gastric and intestinal microflora in Helicobacter pylori–infected patients. J Antimicrob Chemother. 1999 Nov;44(5):629–40.
27. Canani RB et al. Therapy with gastric acidity inhibitors increases the risk of acute gastroenteritis and community–acquired pneumonia in children.Pediatrics. 2006 May;117(5):e817–20
28. Gibson GR, Berry–Ottaway P, Rastall RA. Prebiotics: new developments in functional food. Oxford, UK: Chandos Publishing Limited 2000.
29. Gilbert DN. Infect Dis Clin Pract 1995; 4 (Suppl 2): SI03–S9.
30. Kanerud L. Et al. Effect of sulphasalazine on gastrointestinal microflora and on mucosal heat shock protein expression in patients with rheumatoid arthritis. Br J Rheumatol. 1994 Nov;33(11):1039–48.
31. M. Sjolund, K. Wreiber, D. Andersson et al. Long–Term Persistence of Resistant Enterococcus Species after Antibiotics To Eradicate Helicobacter pylori. Ann Intern Med 2003;139:483–487
32. McCracken VJ, Gaskins HR. Probiotics and the immune system.–in: Tannock GW ed. Probiotics a critical review. Wymondham: Horizon Scintific Press 1999, p. 85–111.
33. Ouwehand A, Isolauri E, Salminen S. The role of intestinal microflora for the development of the immune system in early childhood. Eur J Nutr 2002(suppl. 1):I/32–I/37.
34. Shindo K. et al. Omeprazole induces altered bile acid metabolism. Gut 1998; 42(2):266–271.
35. Weisman Z. Are probiotics beneficial for children’s health? Infant nutrition. 2000. E.Lebenthal, ed. 68–72.

.

Дисбактериоз - миф российской медицины

Тем не менее, как дань дремучим совковым традициям, "дисбактериоз" продолжает слетать с языка многих практикующих врачей, особенно педиатров. По-прежнему стандарты медосмотров малышей включают тестирование кала на "дисбактериоз". При этом давно известно, что искать корреляцию между составом флоры в кале и реальным ее соотношением в криптах кишечника - все равно, что гадать на кофейной гуще. Во-первых, основу кишечной флоры составляют бактероиды, которые не растут на питательных средах. Во-вторых, соотношение бактерий на выходе имеет очень мало общего с тем, что живет в кишке. В-третьих, все то время, пока вы собираете и несете ваши бесценные фекалии в лабораторию, жизнь в них не прекращается, и уже через несколько часов вся флора и фауна кала радикально видоизменяется. А потому все заключения о "преобладании патогенной флоры над нормальной" в таком анализе попросту смехотворны.

В общем, всем нам надо понимать, что такого самостоятельного заболевания, как дисбактериоз, в природе нет.

Существуют лишь ряд временных состояний организма (те же вирусные диареи или длительная антибиотикотерапия), которые могут привести к временному же дисбалансу нормальной флоры. При этом дисбаланс этот, как правило, не качественный, а количественный. В пример могу привести чрезмерный рост бактерии Clostridium difficile с развитием псевдомембранозного колита на фоне длительной терапии антибиотками.

Чаще же всего дискомфорт в животе обусловлен не мифическими заболеваниями, а совершенно реальным бунтом организма против всякой колы и прочей мак-дряни. Если вашего ребенка в животе не прекращается “шум и гам”, в первую очередь посмотрите, что он у вас ест.

У взрослых под "дисбактериозом" нередко скрываются синдром раздраженного кишечника, синдром избыточного бактериального роста в тонкой кишке, лактазная недостаточность, а также другие невыявленные состояния, при которых нарушается баланс кишечной флоры. Эти расстройства надо лечить, воздействуя на причину такого дисбаланса, а не сам дисбаланс, который является лишь следствием.

На теме дисбактериоза активно паразитируют различные производители кисломолочных продуктов питания, пробиотиков (препаратов с живыми бактериальными культурами) и пребиотиков (веществ, не перевариваемых человеком, но являющихся пищей для ряда бактерий).

Как я уже объяснил в колонке о кишечной флоре, бактерии пробиотиков могут становиться лишь транзитными колонистами, тогда как цель всех лечебных мероприятий заключается в восстановлении баланса СОБСТВЕННОЙ микрофлоры.

В ряду многочисленных препаратов для коррекции дисбактериоза хочу выделить особо абсурдный класс лекарств - бактериофаги. Бактериофаги - это такие вирусы, которые поражают бактерий. Когда-то ученые предложили использовать их против стафилококков, кишечных палочек и других возбудителей диарей. Однако исследования показали, что бактериофаги полностью разрушаются в желудке, и от таких препаратов во всем мире давно уже отказались. Точнее, во всем мире, кроме России - у нас эти псевдолекарства популярны и по сей день, и особенно хорошо неэффективные препараты лечат несуществующие дисбактериозы.

Если ваш врач уверенно заявляет, что ваша микрофлора разбалансирована, и вы вовсю уже "страдаете дисбактериозом", не паникуйте! Попытайтесь отыскать грамотного специалиста, который не станет жонглировать несуществующими диагнозами и назначать фуфломицины, а займется общепринятой диагностикой, которая позволит отличить инфекционную или органическую патологию кишечного тракта от физиологических и психосоматических расстройств. И не спешите разоряться в аптеках! Лучше сэкономьте деньги на полноценное питание себе и вашим детям, "подкормите" микрофлору естественным образом - здоровой пищей. Растительные волокна овощей, фруктов и зерновых - лучшая поддержка для

Сдать анализ кала на дисбактериоз кишечника

Метод определения Бактериологический, бактериоскопический

Исследуемый материал Кал

Доступен выезд на дом

Синонимы: Дисбиоз кишечника; Анализ кала на дисбактериоз. 

Intestinal dysbiosis; Intestinal disbios; Intestinal dysbacteriosis. 

Краткое описание исследования «Дисбактериоз кишечника»  

В медицинских офисах Москвы и Московской области приём биоматериала для выполнения теста № 456 производится 7 дней в неделю с ограничениями по времени взятия. Интересующую информацию уточняйте у администраторов медицинских офисов. 

Дисбактериоз (в англоязычной литературе используют термин Intestinal bacterial overgrowth, реже – disbios) острое или хроническое нарушение нормальной микрофлоры кишечника. 

В содержимом тощей кишки здоровых людей может находиться до 105 бактерий в 1 мл кишечного содержимого. Основными являются молочнокислые палочки, стафилококки и стрептококки, другие грамположительные аэробные бактерии и грибы. В дистальном отделе подвздошной кишки количество микробов увеличивается до 108, в первую очередь за счёт энтерококков, кишечной палочки, бактероидов и анаэробных бактерий. В толстой кишке преобладают анаэробы (бактероиды, клостридии, лактобациллы). Этот симбиоз бактерий у здорового человека (и у млекопитающих!) выполняет многие полезные функции: противодействует чужеродным патогенным микробам и вирусам, помогает пищеварению, синтезирует витамины группы В. 

Соотношение количества различных микроорганизмов достаточно постоянно. Но вследствии ослабления иммунитета, нерациональной терапии антибиотиками, лучевой и химиотерапии, врождённых дефектов ферментов баланс нарушается. Могут исчезнуть некоторые представители нормальной микрофлоры (бифидобактерии, молочнокислые и кишечные палочки) и появиться грибки рода кандида, стафилококки, протей, синегнойная палочка. Возникает клинический синдром, для которого характерны понос, стеаторея, снижение веса и анемия. При резком ослаблении защитных сил, иммунитета может развиться генерализованная форма эндогенной инфекции вплоть до сепсиса. 

С какой целью проводят исследование на дисбактериоз кишечника

Исследование микрофлоры кишечника применяют для определения характера нарушения биоценоза кишечника.  

Выявляемые микроорганизмы и возбудители в исследовании «Дисбактериоз кишечника» 

 Выделяемые микроорганизмы и возбудители:  

  • полезные бактерии кишечника – лактобактерии, бифидобактерии, кишечные палочки с типичными свойствами, а также со сниженными ферментативными и гемолитическими признаками; 
  • условно-патогенные бактерии – энтеробактерии, неферментирующие бактерии, стафилококки, энтерококки, анаэробные бактерии (клостридии, без идентификации до вида), грибы; 
  •  патогенные – сальмонеллы, шигеллы.

Литература

Основная литература

  1. Парфенов А. И. Микробная флора кишечника и дисбактериоз РМЖ, 1998, т. 6, №18.
  2. Henry C. Small Intestinal Bacterial Overgrowth and Irritable Bowel Syndrome JAMA. 2004, v.292, pp. 2213 - 2214.

Диагностика дисбактериоза

Дисбиоз - это состояние, при котором кишечные бактерии становятся несбалансированными, что приводит к широкому спектру нарушений пищеварения, включая вздутие живота, диарею, запоры и спазмы желудка, среди прочего. Это состояние было связано с различными заболеваниями, включая синдром раздраженного кишечника (СРК), воспалительное заболевание кишечника и гастрит, и это лишь некоторые из них.

Что такое дисбактериоз?

Дисбактериоз - это нарушение баланса кишечных бактерий.В результате возникает широкий спектр симптомов нарушения пищеварения, включая диарею, спазмы, запор, вздутие живота и несварение желудка. Когда наблюдается несоответствие нормальной микрофлоры кишечника из-за недостатка полезных бактерий и чрезмерного роста вредных бактерий, это может вызвать дисбактериоз.

В микробиоме кишечника обнаружено не менее 400 видов бактерий. Они необходимы для общего здоровья, поскольку помогают пищеварению, борются с патогенными микроорганизмами и синтезируют витамины.Нормальную флору тела можно найти в различных областях, и они необходимы для общего здоровья и хорошего самочувствия. Когда эти бактерии становятся несбалансированными, а вредные подавляют полезные бактерии или бесконтрольно разрастаются, это может вызвать болезнь.

Что вызывает дисбактериоз?

Существует множество факторов, которые могут привести к состоянию, включая чрезмерное или неправильное использование антибиотиков, чрезмерное употребление алкоголя, повышенное потребление сахара или белка, частое использование антацидов, воздействие пестицидов и хронический стресс, и это лишь некоторые из них.Кроме того, плохая гигиена полости рта и беспокойство также могут привести к дисбактериозу.

В некоторых случаях исследования связывают дисбактериоз с рождением через кесарево сечение и вскармливанием смеси среди новорожденных.

Признаки и симптомы дисбактериоза

Основными признаками и симптомами дисбактериоза являются нарушения пищеварения. Люди с этим заболеванием могут испытывать частые газы или вздутие живота. Это означает, что они ощущают вздутие живота почти все дни недели. Кроме того, они страдают от спазмов в животе, диареи и запоров со слизью в стуле.У них может быть сочетание диареи и запора, пищевой чувствительности, пищевой непереносимости и хронического неприятного запаха изо рта.

В некоторых случаях люди могут испытывать затруднения при мочеиспускании, вагинальный или ректальный зуд, боль в груди, сыпь, усталость, проблемы с концентрацией внимания, депрессию, беспокойство и туман в мозгу.

Диагностика дисбактериоза

Врач может диагностировать дисбактериоз на основании признаков и симптомов, истории болезни, физического осмотра и диагностических тестов. У человека может быть дисбактериоз, если у него или нее есть диагноз синдрома раздраженного кишечника (СРК), длительное употребление антибиотиков, аутоиммунное заболевание или гастроэнтерит в анамнезе.Однако для подтверждения диагноза врач может порекомендовать следующие диагностические тесты:

Тесты на органическую кислоту

Врач порекомендует тест на органическую кислоту. Это делается путем сбора пробы мочи и ее исследования в лаборатории. Они будут искать и проверять определенные кислоты, которые выделяют бактерии в кишечнике. Аномальные уровни означают, что некоторые бактерии выходят из-под контроля.

Комплексный анализ пищеварительного стула (CDSA)

Всесторонний анализ стула может дать наиболее глубокий анализ бактерий, как хороших, так и патогенных, которые обитают в кишечнике.Кроме того, исследование стула может определить наличие других оппортунистических инфекций, таких как паразитарные организмы.

Врач разрешит пациенту забрать домой специальное оборудование для сбора пробы стула. Затем образец будет отправлен в лабораторию. Стул будет исследован на наличие бактерий, дрожжей или грибков.

Водородный дыхательный тест

Водородный тест груди определяет наличие газов, производимых бактериями в кишечнике. В водородном дыхательном тесте врач разрешает пациенту выпить раствор глюкозы или сахара.После этого пациент дышит в специальный баллон, где воздух исследуется на наличие газов, производимых бактериями. Когда количество газов слишком велико или слишком много, это может указывать на дисбаланс кишечных бактерий.

Биопсия

Врач может взять образец бактериальной ткани из кишечника, где есть активная инфекция, чтобы увидеть, какой тип бактерий присутствует.

Лечение дисбактериоза - это больше, чем просто прием пробиотиков для поддержания баланса в кишечнике.Это как-то связано с правильным выбором пищи, отказом от определенных продуктов и занятий, ограничением потребления алкоголя или его полным искоренением. Соблюдение здоровой диеты и сокращение количества потребляемого сахара и пищевых добавок - многообещающий способ обуздать дисбактериоз и сохранить здоровье кишечника.

Дополнительная литература

Роль дисбактериоза в вашем здоровье

Дисбактериоз - это состояние, при котором наблюдается дисбаланс микроорганизмов в нашем организме или внутри него. В равновесии эти колонии микроорганизмов имеют тенденцию оказывать благоприятное воздействие на наш организм.Когда есть дисбаланс, мы можем испытывать нежелательные симптомы.

jamesbenet / E + / Getty Images

Обзор

Дисбактериоз кишечной микробиоты, также известный как дисбактериоз кишечника или желудочно-кишечного тракта, относится к состоянию, при котором наблюдается дисбаланс микроорганизмов в нашем кишечнике. Эти микроорганизмы, известные под общим названием кишечная флора, состоят преимущественно из различных штаммов бактерий и в меньшей степени включают грибы и простейшие. Флора кишечника необходима для пищеварения и функционирования иммунной системы.Таким образом, состояние дисбактериоза приводит к появлению пищеварительных и других системных симптомов.

Проблемы со здоровьем, вызванные дисбактериозом кишечника

Было установлено, что дисбактериоз играет возможную роль в возникновении множества проблем со здоровьем. Не всегда понятно, в чем может состоять эта роль. Предполагается, что баланс кишечных бактерий может влиять на иммунную систему и здоровье слизистой оболочки кишечника (повышенная кишечная проницаемость). Как видите, не все состояния здоровья, при которых может иметь место дисбактериоз, имеют пищеварительную природу:

Причины

Дисбиоз отражает изменение популяции различных микробов, поскольку бесполезные микробы преобладают над более полезными.К сожалению, это имеет тенденцию иметь эффект снежного кома, поскольку меньшее количество полезных микробов становится все менее и менее способным удерживать «недружественные» микробы от размножения. Дисбиоз также может быть результатом изменения расположения различных типов микроорганизмов в кишечнике или изменения того, как они действуют.

Некоторые факторы, которые, по-видимому, способствуют состоянию дисбактериоза, включают:

  • Использование антибиотиков (от лекарств или от потребления продуктов животного происхождения, обработанных антибиотиками)
  • Нездоровое питание (с недостатком питательных веществ и клетчатки или содержащее вредные вещества)
  • Злоупотребление алкоголем
  • Вторично по отношению к соматическому заболеванию, например химиотерапии для рак
  • Высокий жизненный стресс

Улучшение здоровья кишечника

Теоретически от дисбактериоза можно избавиться за счет улучшения привычек питания и образа жизни, таких как сбалансированное и питательное питание и применение техник управления стрессом, связанных с разумом и телом.Некоторые практикующие альтернативные врачи рекомендуют использовать костный бульон, но клинических исследований, подтверждающих эту рекомендацию, нет.

Исследования взаимосвязи между дисбактериозом кишечника и нашим здоровьем все еще находятся на предварительной стадии, хотя они быстро расширяются. На данный момент существует несколько вариантов лечения, которые получили некоторую исследовательскую поддержку для улучшения состояния дисбактериоза:

Для людей с синдромом раздраженного кишечника существует специальный антибиотик под названием Ксифаксан (рифаксимин), который борется с дисбактериозом в кишечнике.Взаимодействие с другими людьми

На данный момент эта область медицины все еще находится на начальной стадии. Четкая информация об улучшении дисбактериоза и о том, как это повлияет на нарушения здоровья, пока недоступна. Однако эта область исследований представляется многообещающей.

Факты о дисбактериозе кишечника и как его вылечить

Вы разделяете свое тело с триллионами микроскопических организмов. Когда они не ладят, это называется «дисбактериозом», и это имеет косвенные последствия для вашего здоровья.

Дисбиоз - это современная проблема, которая возникла, когда ученые открыли поразительное разнообразие микробов, обитающих в человеческом теле и внутри него. По большей части эти одноклеточные организмы безвредны (некоторые даже хороши) и живут в симбиозе с вами, хозяином.

Но микробы - чувствительные маленькие существа, и их гармоничные сообщества легко вывести из равновесия. Это позволяет менее дружелюбным насекомым брать на себя ответственность и делать то, что им лучше всего подходит - а это не всегда то, что нужно вашему организму.Это упрощенное определение дисбактериоза .

В этой статье вы познакомитесь с причинами дисбактериоза, его симптомами, тестированием и лечением. Вы обнаружите, что дисбактериоз - удивительно распространенная проблема, и почему исследователи до сих пор не уверены в том, что первично: дисбактериоз или болезнь.

☝️ ОТКАЗ ОТ ОТВЕТСТВЕННОСТИ ☝Эта статья предназначена только для информационных целей. Он не предназначен для использования в качестве замены профессиональных медицинских рекомендаций, диагностики или лечения.


Содержание


Что такое дисбактериоз?

Дисбиоз определяется как негативные изменения в микробных сообществах вашего тела, которые связаны с проблемами со здоровьем и заболеваниями. Выделяют два основных типа дисбактериоза: бактериальный и грибковый. Однако дисбактериоз не является заболеванием.

Дисбиоз - это универсальный термин, потому что не существует «идеального» микробиома. Каждый человек уникален, а это означает, что каждый микробиом тоже уникален.Однако исследователи выявили некоторые общие признаки дисбактериоза, которые связаны с количеством одних микробов по сравнению с другими:

  • Разрастание некоторых бактерий или дрожжей
  • Отсутствие или недостаток полезных бактерий
  • Низкое разнообразие видов в микробиоме

Грибковый дисбактериоз

В организме также обитает небольшое количество дрожжей, которые по большей части безвредны. Тем не менее, грибковый рост - частая причина инфекций уха, микоза, молочницы и вагинальных инфекций, многие из которых вызываются дрожжами Candida и плесенью Aspergillus.

☝️ СОВЕТ ☝️ Значение дисбактериоза происходит от древнегреческого: дис- (плохой или больной) и биоз (образ жизни).

Что такое дисбактериоз кишечника?

Самая известная микробная экосистема - это микробиом кишечника. Расположенный в толстой кишке, он содержит триллионы бактериальных клеток, которые работают с кишечником, чтобы поддерживать его здоровье. Также там есть дрожжи, грибы и археи.

В здоровом и сбалансированном микробиоме содержится достаточно нужных бактерий для производства важных питательных веществ, которые поддерживают здоровье кишечника и защищают от вторжений, которые могут вызвать дисбактериоз, захватив экосистему.

Разнообразие - это ключевой показатель для измерения дисбактериоза кишечного микробиома. В здоровом микробиоме присутствует более 1000 различных видов бактерий. Они контролируют чужеродные бактерии и потенциально инфекционные микробы, чтобы они не могли размножаться и вызывать болезни.

Что вызывает дисбактериоз кишечника?

Иллюстрация сделана на основе обзора о дисбактериозе, проведенного ДеГруттола А.К. и другие.

В вашей повседневной жизни есть множество факторов, которые могут повлиять на дисбактериоз толстой кишки и здоровье микробиома, самым большим из которых являются антибиотики.Даже всего один курс антибиотиков может вызвать дисбактериоз, который длится месяцами. Многократный прием антибиотиков может даже навсегда нарушить микробиом кишечника.

Другие факторы, связанные с дисбактериозом кишечника, включают вашу диету и образ жизни. Вечеринки каждый вечер и питание за счет фаст-фуда и сладких напитков не принесут пользы вашему кишечнику, а вот употребление большого количества цельных продуктов, фруктов и овощей и регулярные физические упражнения принесут пользу.

Практически невозможно определить, является ли дисбактериоз частью проблемы или просто следствием болезни.Исследователи полагают, что это, вероятно, порочный круг, в котором микробиом кишечника и организм создают условия для болезни.

Действительно, болезнь (и даже прием лекарств) может повлиять на микробиом, вызывая дисбактериоз, который затем подпитывает болезнь. Точно так же считается, что дисбактериоз может вызывать проблемы с обменом веществ в организме, которые в дальнейшем повышают восприимчивость человека к болезням.

Симптомы дисбактериоза

Симптомы дисбактериоза кишечника очень расплывчаты и совпадают со многими распространенными проблемами со здоровьем, включая синдром раздраженного кишечника, воспалительное заболевание кишечника и целиакию.Исследования также показывают, что дисбактериоз является фактором риска развития этих состояний.

Общие симптомы дисбактериоза кишечника:

  • метеоризм
  • вздутие живота
  • Боль в животе
  • понос
  • запор

Просто помните, если у вас есть симптомы дисбактериоза кишечника, вам всегда следует обращаться к врачу для диагностического обследования, чтобы убедиться, что у вас нет серьезных проблем со здоровьем.

Тесты на дисбактериоз

Дисбактериоз - это слово, используемое для описания функционального состояния. Это не диагноз, потому что оно не считается состоянием здоровья.

Если вы хотите проверить наличие дисбактериоза кишечника, вы можете пройти тест на микробиом кишечника, например, тест на микробиом Атласа. Их не называют тестами на дисбактериоз кишечника, потому что они анализируют многие особенности кишечной микробиоты, а не только дисбактериоз.

Вы можете заказать тест на микробиом Атлас онлайн прямо сейчас и получить набор для сбора, который будет доставлен к вам домой. Все, что вам нужно сделать, это собрать небольшой образец стула и вернуть его. Ваш образец анализируется в лаборатории, чтобы определить бактерии в кишечнике и их влияние на ваше здоровье.

Отчет Что вы узнаете
Разнообразие микробиома Узнайте, насколько разнообразен микробиом вашего кишечника и является ли дисбактериоз проблемой.
Полезные бактерии Узнайте о полезных бактериях в кишечнике и о том, достаточно ли у вас их для защиты от дисбактериоза.
Уровни бутирата Узнайте, производят ли ваши бактерии достаточно бутирата, чтобы поддерживать здоровье кишечника.
Метаболизм пищевых волокон Выясните, насколько хорошо кишечные микробы расщепляют различные пищевые волокна.
Защита от болезней Узнайте, как кишечные микробы защищают вас от 5 болезней, связанных с дисбактериозом.
Синтез витаминов Узнайте, производят ли ваши микробы достаточно витаминов B и K, чтобы прокормить сообщество.
Диета при дисбактериозе Открывайте индивидуальные списки продуктов каждую неделю, чтобы восстановить микробиом кишечника и бороться с дисбактериозом.

Хотя универсального определения дисбактериоза не существует, существует достаточно доказательств, чтобы знать, как выглядит сбалансированный микробиом. Вот почему тесты на микробиом кишечника - хороший вариант, если вас беспокоит дисбактериоз.

Разнообразие тестов на дисбактериоз

Микробиомные тесты - лучший способ проверить разнообразие вашего микробиома - основной индикатор здоровья - который показывает, счастливы и сбалансированы ваши кишечные бактерии, или есть ли избыток одних бактерий и недостаток других.

Когда в кишечнике недостаточно полезных и пробиотических бактерий, вы более подвержены дисбактериозу. Вот почему микробиомный тест Atlas также проверяет количество пробиотических бактерий, таких как Lactobacillus и Bifidobacteria , а также других полезных бактерий в кишечнике.

Питательный тест на дисбактериоз

Тесты, такие как микробиомный тест Атлас, могут оценить уровень бутирата (критически важной короткоцепочечной жирной кислоты), вырабатываемой вашими бактериями для поддержания здоровья кишечника.Кишечные микробы также производят витамины, которые питают другие бактерии, и вы можете увидеть, как здесь живет ваш микробиом.

Статус защиты от болезней

Дисбактериоз часто наблюдается при серьезных заболеваниях, и наш тест на микробиом может оценить, насколько микробиом вашего кишечника похож или отличается от пяти распространенных заболеваний:

  • Болезнь Крона
  • Язвенный колит
  • Ожирение
  • Болезнь сердца
  • Сахарный диабет II типа

Лечение дисбактериоза кишечника

Лечение дисбактериоза следует подбирать индивидуально для каждого человека с учетом результатов теста на микробиом кишечника.Протокол дисбактериоза кишечника может включать комбинацию диетических изменений, пробиотических добавок и изменений образа жизни для создания оптимальных условий для процветания полезных бактерий.

Получите еженедельные индивидуальные рекомендации по питанию для борьбы с дисбактериозом

Не существует лекарства, которое могло бы лечить симптомы дисбактериоза кишечника, и лечение обычно разрабатывается для каждого конкретного случая. При умеренном дисбалансе микробиома, выявленном с помощью теста микробиома Атласа, ваши еженедельные рекомендации по питанию - это диета для лечения дисбактериоза.

Кормя свой микробиом пребиотическими продуктами, вы подпитываете полезные бактерии в кишечнике, чтобы они могли процветать и восстанавливать баланс в экосистеме. Пребиотики - это просто причудливое слово для обозначения растительной пищи, потому что полезные кишечные бактерии питаются пищевыми волокнами и питательными веществами для растений.

Дневник питания Atlas Biomed для здоровья микробиома

Эта индивидуальная диета от дисбактериоза - естественное средство от дисбактериоза, не требующее никаких добавок или лекарств. Все, что вам нужно сделать, это следовать своим еженедельным рекомендациям по питанию и записывать свой прогресс в приложении Atlas Health.

В этом приложении есть встроенная функция подсчета очков, позволяющая оценивать ваши блюда на основе того, насколько они благоприятны для микробиома, чтобы помочь вам придерживаться диеты при дисбактериозе кишечника. Кроме того, вы можете получить бесплатную консультацию диетолога и попросить совета у профессионала.

Отслеживайте состояние своего микробиома с течением времени с помощью нашей тестовой подписки

. С помощью нашей подписки вы даже можете отслеживать, насколько эффективна ваша диета для лечения дисбактериоза кишечника. Проходите тест на микробиом Atlas каждые три месяца, чтобы увидеть, как меняется ваш микробиом и как он реагирует на улучшения в выборе продуктов питания.



Другие виды дисбактериоза

Дисбактериоз поражает не только толстую кишку. Это может повлиять на любую часть тела, которая имеет свою особую экосистему микробов, потому что бактерии повсюду, от вашего рта до мочевыводящих путей.

Дисбактериоз кожи

Только ваша кожа имеет несколько нишевых микробиомов, зависящих от местной окружающей среды. Например, микробы, которым нравится жирная кожа вашего носа, скорее всего, не будут получать столько удовольствия от ваших потных подмышек.

Действительно, некоторые исследования показали, что перхоть и себорейный дерматит (зудящая сыпь с шелушащимися чешуйками) связаны с грибковым и бактериальным дисбиозом. Атопический дерматит, более известный как экзема, также связан с дисбактериозом микробиома кожи.

Дисбактериоз полости рта

Дисбактериоз полости рта - еще одна распространенная проблема, которая может иметь серьезные последствия. Гингивит и пародонтит (две стадии заболевания десен) связаны с дисбактериозом ротовой полости, вызываемым бактерией Porphyromonas gingivalis .

Чрезмерный рост P. gingivalis означает, что эти микробы могут путешествовать с вашей слюной в пищеварительный тракт, где они могут активировать вашу иммунную систему, вызывая хроническое воспаление и дисбактериоз микробиома кишечника.

Чрезмерный бактериальный рост в тонком кишечнике (SIBO)

Ваш кишечник состоит из двух частей. Тонкий кишечник извлекает большую часть энергии и питательных веществ из пищи, в то время как толстый кишечник поглощает воду, электролиты и некоторые другие питательные вещества и избавляется от продуктов жизнедеятельности.

СИБР - это тип дисбактериоза, при котором избыточный бактериальный рост приводит к избыточной выработке метана или водорода. Эти газы влияют на клетки слизистой оболочки кишечника, вызывая вздутие живота, боли в животе, газообразование, диарею и иногда запор.

Кандидозный дисбактериоз

Candida - это обычно безвредные дрожжи, которые иногда бесконтрольно вырастают и захватывают местный микробиом с неприятными побочными эффектами. Чрезмерный рост Candida - это форма дисбактериоза, известная как кандидоз.

Дрожжи Candida могут вызывать молочницу - грибковый дисбактериоз ротовой полости - с неприятными симптомами, такими как болезненность, белые или желтые пятна, которые кровоточат при соскабливании, неприятный привкус во рту, сухость и трещины на краях рта.

Другой распространенный тип грибкового дисбактериоза Candida поражает только женщин: дрожжевые инфекции. В вагинальном микробиоме преобладают бактерии Lactobacillus , которые поддерживают кислотность окружающей среды для отпугивания патогенов. Когда эта экосистема нарушена (например, антибиотиками), дрожжи кандиды могут взять верх и вызвать вагинальную инфекцию.

☝️ FACT ☝️ Микробиомные тесты не могут показать вам, есть ли у вас грибковый рост, дисбактериоз кожи или паразитарная инфекция.

Что такое дисбактериоз: как бактерии в вашем теле разрушают ваше здоровье

Дисбактериоз - это заболевание, от которого страдают многие люди, независимо от того, осознают они это или нет. Дисбиоз связан с такими заболеваниями, как СРК, болезнь Крона, язвенный колит, аутизм и ожирение. И хотя это обычное заболевание, его влияние на организм все еще в значительной степени неправильно понимается.

В этой статье будет рассказано, что такое дисбактериоз, каковы его причины и как его лечить.

Во-первых, разберемся, что такое дисбактериоз.

Что такое дисбактериоз?

Дисбактериоз или дисбактериоз - это нарушение баланса микробных сообществ в организме. Это может проявляться в более высокой распространенности определенных бактерий, отсутствии бактерий и недостаточном разнообразии бактерий. Дисбаланс может возникнуть на любом из участков тела с микробами, включая кожу, кишечник, влагалище и нос.

Дисбиоз обычно ассоциируется с заболеваниями, связанными с ЖКТ, такими как СИБР, болезнь Крона, язвенный колит и другие. Хотя дисбактериоз связан не только с микробиомом кишечника, он также может влиять на другие микробиомы тела, включая кожу, рот и нос.

Что вызывает дисбактериоз?

Есть некоторые известные факторы, вызывающие дисбактериоз, но не все факторы известны или полностью изучены. Среди известных факторов, которые могут привести к дисбактериозу, - изменение диеты, прием антибиотиков и стресс.Часто дисбактериоз возникает из-за комбинации этих факторов, и предрасположенности также могут играть роль.

Исследования показали, что воздействие дезинфицирующих средств, бытовых чистящих средств и других химикатов, особенно в молодом возрасте, может привести к увеличению риска дисбактериоза. Метод родов также считается предрасполагающим фактором риска развития дисбактериоза. Те, кто родился путем кесарева сечения, а не естественным путем, представляют более высокий риск дисбактериоза и состояний, связанных с дисбактериозом.

Кто подвержен риску дисбактериоза?

Предрасположенность, образ жизни и окружающая среда могут подвергнуть человека более высокому риску развития дисбактериоза.Дети, рожденные в результате кесарева сечения, представляют собой более высокий риск, как и дети, которые в раннем возрасте подвергаются высокому воздействию дезинфицирующих средств и антибиотиков. Это связано с высокой пластичностью микробиома на этапах развития детства.

Для пожилых людей окружающая среда и состояние здоровья могут способствовать риску. Опять же, употребление антибиотиков увеличивает риск, а также увеличивает стресс и ослабляет иммунную систему. Те, кто находится в больнице или в учреждениях долгосрочного медицинского обслуживания, подвергаются повышенному риску дисбактериоза, чем те, кто живет самостоятельно, с меньшим количеством бактериальных и вирусных воздействий.

Симптомы и состояния дисбактериоза

Симптомы дисбактериоза зависят от типа и расположения бактериального дисбаланса в организме. Дисбиоз может произойти в любой нише микробиома, включая микробиом кишечника, микробиом кожи, микробиом полости рта и многое другое. Симптомы могут быть от легких до тяжелых и могут быть связаны с другими состояниями, помимо дисбактериоза.

Общие симптомы дисбактериоза включают:

  • Тошнота
  • Расстройство желудка
  • Диарея
  • Запор
  • Вздутие живота
  • Усталость
  • Затрудненное мочеиспускание
  • Галитоз (неприятный запах изо рта)
  • Боль в груди
  • Сыпь
  • Проблемы с концентрацией
  • Беспокойство
  • Депрессия

Если вы испытываете какие-либо из этих симптомов в течение длительных периодов времени или хронически, вам следует проконсультироваться с врачом.

Состояния, связанные с дисбактериозом

Когда мы говорим о дисбактериозе и связанных с ним состояниях, мы имеем дело с цыпленком и яйцом. Является ли микробиом при дисбактериозе причиной воспаления или воспаление причиной дисбактериоза, или, возможно, это сочетание причины и следствия. В любом случае исследователи выявили связь между следующими заболеваниями / состояниями и дисбактериозом:

Связь между дисбактериозом и этими состояниями привела к появлению новых видов лечения, включая трансплантацию фекальной микробиоты (FMT) и другие курсы лечения, ориентированные на бактерии.

Исцеление от дисбактериоза кишечника

Дисбактериоз может быть сложно поддающимся лечению состоянием, но есть определенные диеты и методы лечения, которые, как было доказано, уменьшают симптомы дисбактериоза. Некоторые люди придерживаются диеты FODMAP, в то время как другие используют конкретную углеводную диету, какой бы она ни была, диета может быть эффективным способом уменьшить бактериальный дисбаланс.

Еда:

  • Темная листовая зелень, например, шпинат и капуста
  • Рыба
  • Свежее мясо (без мясной обработки)

Продукты, которых следует избегать:

  • Молочная промышленность
  • Продукты с высоким содержанием сахара Мясные полуфабрикаты
  • Простые углеводы, такие как кукуруза, овес или хлеб
  • Некоторые фрукты, такие как бананы, яблоки и виноград

Существуют также методы лечения дисбактериоза, а именно FMT.

Трансплантаты фекальной микробиоты все чаще используются для лечения дисбактериоза. Лечение включает пересадку стула от здорового донора в кишечник человека с дисбактериозом. При трансплантации кал, который является богатым источником микробиоты (то есть бактерий, грибков, простейших и вирусов), способен помочь ослабленному микробиому пациента и вернуть его в более сбалансированное и здоровое состояние.

Выявление дисбактериоза кишечника: каковы симптомы?

Что такое дисбактериоз кишечника?

Дисбактериоз - это бактериальный дисбаланс в пищеварительном тракте.В вашем кишечнике содержится до 100 триллионов бактерий - это больше, чем общее количество клеток в организме человека, при этом до 1000 различных видов играют решающую роль в здоровье кишечника. В идеале вы хотите, чтобы большинство кишечных бактерий были полезными типами, вырабатывающими молочную кислоту, такими как лактобациллы и бифидобактерии, с меньшим количеством менее полезных типов бактерий, которые имеют тенденцию выделять газ и неприятные запахи. Когда баланс бактерий нарушается, так что количество менее желательных бактерий превышает количество хороших, тогда у вас дисбактериоз или дисбактериоз.

Что вызывает дисбактериоз кишечника?

Ваш кишечник предназначен для регулярного опорожнения, а это означает, что вы ежедневно теряете полезные пробиотические бактерии вместе с их менее желанными родственниками. Обычно эти «хорошие» бактерии пополняются за счет размножения бактерий, которые прилипают к стенке кишечника и живут внутри вашего аппендикса (если он у вас еще есть), поскольку этот слепой мешочек действует как резервуар для бактерий.

Тип диеты, которую вы едите, оказывает сильное влияние на бактериальный баланс кишечника, поскольку разные виды бактерий питаются разными типами углеводов, клетчатки и белков.Новые исследования на нечеловеческих приматах показывают, что соблюдение средиземноморской диеты, включающей большое количество овощей, рыбы и оливкового масла, может повысить уровень пробиотических бактерий в кишечнике почти на 10% по сравнению с богатой мясом диетой в западном стиле. 1 Вполне вероятно, что аналогичные эффекты будут иметь место и у людей. Факторы образа жизни, такие как алкоголь и курение, также могут повлиять на бактериальный баланс кишечника. 2

Дисбиоз развивается, когда уровень пробиотических бактерий снижается, а другие виды бактерий становятся чрезмерно многочисленными.Это может произойти в любое время, но чаще всего возникает после приема антибиотиков широкого спектра действия, которые убивают ваши «хорошие» пробиотические бактерии, а также вредные инфекции. 3

Еще одним фактором, влияющим на микробный баланс кишечника, является физический и психологический стресс, который подавляет иммунитет и увеличивает опорожнение кишечника как часть реакции борьбы или бегства (для облегчения бега).

Каковы симптомы дисбактериоза кишечника?

Баланс бактерий в кишечнике оказывает удивительное влияние на общее состояние здоровья - от того, насколько хорошо вы перевариваете пищу и усваиваете витамины и минералы, до того, как вы обрабатываете лекарства.

Бактерии кишечника помогают иммунной системе бороться с инфекциями и регулируют выработку серотонина в стенке кишечника, который регулирует сокращения кишечника. Как нейромедиатор серотонин также участвует в регулировании настроения в головном мозге. Поэтому неудивительно, что дисбактериоз может вызывать широкий спектр как физических, так и психологических симптомов, но его часто упускают из виду как причину плохого здоровья.

Считается, что дисбактериоз кишечника играет роль во многих долгосрочных (хронических) состояниях, включая синдром раздраженного кишечника и воспалительные состояния, такие как язвенный колит 4 и ревматоидный артрит.Дисбиоз также был связан с тревогой и депрессией и даже с увеличением веса и диабетом 2 типа 5 из-за воздействия на гормоны голода и инсулинорезистентность.

Как дисбактериоз вызывает симптомы?

Точный способ, которым дисбактериоз вызывает многочисленные симптомы по всему телу, полностью не изучен, но существуют теории: 6

  • Повышенное воздействие вредных бактериальных химикатов, таких как эндотоксины, сероводород, фенолы, аммиак и индолы
  • Воздействие на блуждающий нерв, соединяющий мозг и кишечник
  • Снижение ферментации клетчатки и более низкие уровни полезных короткоцепочечных жирных кислот (ацетат, бутират, пропионат)
  • Воздействие на иммунные клетки, которые «запрограммированы» в лимфатической ткани стенки кишечника
  • Взаимодействия между крошечными полосками бактериального генетического кода (микроРНК) и ДНК в клетках человека.

Ранние симптомы дисбактериоза в основном поражают кишечник, и одним из первых признаков аномального брожения является вздутие живота. Это может прогрессировать и вызывать изменение привычки кишечника, такое как запор или диарея, часто сопровождающиеся схваткообразными болями. Хотя эти симптомы могут быть совместимы с синдромом раздраженного кишечника, это не тот диагноз, который вам следует ставить самостоятельно. Всегда обращайтесь за медицинской помощью, если вы испытываете изменения в привычке кишечника - особенно если вы также замечаете другие симптомы, вызывающие тревогу, такие как неожиданная потеря веса или кровь в стуле (это может быть признаком рака кишечника, который при ранней диагностике легче лечится. ).

Другие симптомы, которые могут быть признаком дисбактериоза, включают усталость, боль в суставах, плохую концентрацию внимания, беспокойство и даже депрессию. 7 . У разных людей будут разные симптомы, частично основанные на балансе бактерий, присутствующих в их кишечнике, и на том, как они взаимодействуют с унаследованными вами генами.

Как характер кишечных микробов влияет на ваше здоровье

Ученые недавно обнаружили, что все мы можем принадлежать к одному из трех различных видов кишечных бактерий или энтеротипов, которые столь же различны, как и ваша группа крови. 8 Ваш бактериальный баланс - будь то доминирующий Bacteroides, доминирующий Prevotella или доминирующий Ruminococcus - по-видимому, влияет на вашу эффективность в извлечении энергии из пищи и может объяснить, почему некоторым людям труднее похудеть, чем другим.

Характер кишечных бактерий может даже определять, насколько хорошо вы реагируете на некоторые лекарства, какие заболевания у вас развиваются, и на вашу предрасположенность к дефициту витаминов. Например, у людей из группы Bacteroides были более высокие уровни витаминов C, B2 и B5, в то время как у людей из группы Prevotella были более высокие уровни B1 и фолиевой кислоты.

Что делать, если вы считаете, что у вас дисбактериоз

Похоже, что почти любой стойкий физический или психологический симптом может быть связан с дисбактериозом. Если вы продолжаете испытывать проблемы со здоровьем, важно обратиться к врачу.

В настоящее время медицинское признание роли дисбактериоза в здоровье человека мало, и вряд ли ваш врач немедленно возьмется за образец стула. Однако исследователи предсказывают, что в течение пяти лет врачи будут оценивать ваш микробиом и назначать лекарственные препараты и дозы в зависимости от типа вашего кишечника в качестве формы индивидуальной медицины.Использование трансплантатов кишечных микробов (известное как трансфузия) может даже стать мейнстримом.

В то же время лучший способ поддержать здоровый микробный баланс в кишечнике - это придерживаться здоровой средиземноморской диеты и регулярно пополнять пробиотические бактерии - в идеале - ежедневно - с помощью пробиотических добавок. Пребиотики (например, фруктоолигосахариды) также способствуют росту и выживанию пробиотических бактерий, предоставляя вашим «хорошим» бактериям источник пищи, который они могут ферментировать для процветания.

Если вы хотите узнать больше о преимуществах сохранения здоровья кишечника, выберите «Пищеварение» в меню «Ваше здоровье» выше.

Д-р Сара Брюэр - медицинский директор Healthspan, имеет ученую степень в области естественных наук, хирургии и медицины Кембриджского университета. Работая терапевтом и врачом в больнице, доктор Сара теперь имеет степень магистра медицины питания в Университете Суррея и специализируется на питании. Она также является отмеченным наградами писателем и автором.

Узнайте больше на сайте Dr.Веб-сайт Сары Брюэр или узнайте больше об экспертах Healthspan в области здравоохранения.

Микробный дисбактериоз тонкого кишечника лежит в основе симптомов, связанных с функциональными желудочно-кишечными расстройствами

Этическое одобрение исследований на людях

Все исследования на людях были одобрены Mayo Clinic IRB [тестовые образцы (16–006388 и 15–003235), контрольные образцы здоровых людей (14–002382) и 15–003603)], и мы соблюдаем все соответствующие этические нормы. Исследование диетического вмешательства было зарегистрировано в ClinicalTrials.gov (NCT03266536). Все субъекты исследования питания дали информированное согласие, тогда как аспираты тонкой кишки были получены из лаборатории клинической микробиологии в соответствии с отказом от согласия IRB для протокола 15–003235. Биологические материалы, полученные от пациентов, не могут быть переданы на основании протокола, одобренного институциональным IRB.

Сбор аспиратов тонкой кишки

Последовательные образцы аспиратов тонкой кишки от пациентов с симптомами после диагностической ФГДС были получены непосредственно из микробиологической лаборатории с мая по декабрь 2016 года.Образцы дуоденального аспирата собирали во время EGD после прямого прохождения в двенадцатиперстную кишку с минимальным раздувом в желудке с использованием стандартного однопросветного аспирационного катетера, пропущенного через всасывающий порт эндоскопа. Были включены образцы, связанные с пациентами, которые ранее давали согласие на просмотр электронных медицинских карт. Всего за этот промежуток времени было получено 143 аспирата от пациентов с симптомами. После исключения образцов из-за отсутствия согласия или низкой глубины считывания при секвенировании (<1000) было включено в общей сложности 126 пациентов с симптомами.Дуоденальные аспираты, полученные от 38 здоровых добровольцев, участвовавших в других исследованиях и собранные аналогичным образом, также были получены и обработаны аналогичным образом. Клинические метаданные были получены ретроспективным обзором электронной медицинской карты, включая демографическую информацию, ИМТ, клинические показания для тестирования SIBO, количественные результаты аэробных и анаэробных аспиратных культур, курс антибиотиков для лечения SIBO, клинический ответ на антибиотики, необходимость повторного приема антибиотиков, недавние лекарства включая использование антибиотиков и ИПП, операции на желудочно-кишечном тракте, сопутствующие заболевания и т. д.

Критерии диагностики SIBO на основе количественных культур

Аспираты тонкой кишки (10 мкл) наносили штрихами на RBAP (кровяной агар), REMB (грамотрицательная селекционная среда), RBAPA (предварительно восстановленный кровяной агар) и инкубировали в аэробных условиях при + грамположительный селективный) и инкубировали анаэробно либо в клинической лаборатории, либо в исследовательской лаборатории.Общее количество бактерий (анаэробное плюс аэробное количество) было меньше или больше 10 5 КОЕ / мл, а диагноз SIBO был основан на культуре дуоденального аспирата, демонстрирующей ≥ 10 5 КОЕ / мл бактериального роста (аэробный, анаэробный или оба) более 48 часов 15,16,17 .

Сравнение культур и секвенирование 16S рРНК

Бактериальная ДНК была извлечена из аспиратов и биопсий двенадцатиперстной кишки с использованием фенол-хлороформа и из стула с использованием набора для экстракции фекальной ДНК MoBio с последующей амплификацией 16 S рРНК с использованием праймеров, совместимых с библиотекой Nextera, фланкирующих V4 гипервариабельная область ([прямое выступание] + 515 F: [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG] GTGCCAGCMGCCGCGGTAA; и [обратный выступ] + 806 R: [GTCTCGTGGGCTCGGAGATGTGTATA 90 с использованием протокола секвенирования 90 и двойного GGACT 45 с использованием протокола 90 и двойного секвенирования 90 GGACT 45).Все образцы секвенировали вместе в режиме парных концов 2 × 300 на приборе Illumina MiSeq с использованием реагентов v3, разработанных Центром геномики Университета Миннесоты.

Сырые последовательности с парными концами были отфильтрованы по качеству, обрезаны адаптером и сшиты с использованием конвейера контроля качества SHI7 35 , с порогом обрезки> 32 и средним показателем качества> 35. Предварительно обработанные считывания анализировались закрытым подбором эталонов. с ускоренным механизмом оптимального выравнивания с зазором BURST 36,37 в режиме CAPITALIST против баз данных NCBI RefSeq Target Loci Project о бактериальных и архейных 16 S (https: // www.ncbi.nlm.nih.gov/refseq/targetedloci/) с 97-процентной идентичностью. После фильтрации образцов с низкой глубиной считывания мы приступили к анализу 126 пациентов с симптомами и 38 здоровых людей из контрольной группы. Анализ разнообразия проводился с использованием QIIME v1.9.1 38 , а другие анализы данных, статистические тесты и визуализации были выполнены в R. Для сравнения разнообразия различных типов образцов желудочно-кишечного тракта в исследовании диетических вмешательств последовательности были разрежены до средней глубины. сайта с наименьшим количеством чтений, CLR (центрированное логарифмическое соотношение) - преобразовано после мультипликативной замены и проанализировано с помощью пользовательских сценариев R и пакета «vegan ».

Дифференциальный анализ численности между здоровыми и имеющими симптомы субъектами был выполнен на нормализованных данных численности 39 для каждого таксономического ранга с использованием теста перестановки (1000 перестановок) с t-статистикой в ​​качестве статистики критерия. Перед тестированием к нормированным данным о численности применялось преобразование квадратного корня. Таксоны с распространенностью <10% или максимальной долей <0,2% были исключены из тестирования. Контроль FDR (процедура Бенджамини – Хохберга) выполнялся для каждого таксономического ранга для корректировки множественного тестирования.SI был сгенерирован с использованием классификации случайных лесов на основе нормализованных данных уровня OTU (пакет randomForest в R). Шкала индекса была определена как вероятность отсутствия симптомов классификации пациентов на основе сгенерированной модели. Этот метод предотвращает перетренированность, удерживая образец для классификации и прогнозируя на основе оставшегося набора данных n -1. Функция Boruta 40 selection (пакет Boruta на R) использовалась для определения OTU, которые вносят значительный вклад в классификацию.Связи с семью демографическими или клиническими переменными были протестированы с использованием моделей линейной регрессии и скорректированы для множественного тестирования с использованием контроля FDR.

Мы сгенерировали DI с помощью метода CLOUD 24 . Вкратце, матрица расстояний Эйчисона здоровых образцов использовалась в качестве эталонного облака, и расстояние от каждого здорового образца до здорового облака было рассчитано для каждого образца в наборе данных. Затем этот расчет расстояния был повторен для каждой выборки пациентов с симптомами относительно здорового облака; расстояния, превышающие два стандартных отклонения (SD) от среднего значения расстояния до здорового человека, считаются «дисбиотическими»; те, кто находится в пределах 2 SD от среднего значения расстояния до здорового человека, считаются «подобными здоровью».Затем эта оценка дисбактериоза CLOUD была подтверждена с использованием ортогонального подхода, основанного на показателях SI: мы подгоняли показатели SI здоровых к распределению по логит-шкале (значения SI здорового контроля приблизительно нормальны по логит-шкале; p = 0,41, нормальность Шапиро-Уилка тест). Мы снова применили правило 2 SD, классифицируя образцы с более чем 2 SD от среднего значения распределения здоровых людей как «дисбиотические», а образцы в пределах 2 SD как «аналогичные здоровым». Чтобы сгенерировать DI здесь, мы затем повторно классифицировали выборки по случайному лесу с использованием новых групповых классификаций и использовали OOB вероятность «дисбиотической» классификации в качестве показателя индекса.Эти два независимых метода находятся в тесном согласии, что оценивается по высокой степени корреляции между показателями ОБЛАЧНОГО дисбиоза в образцах и их индексом, основанным на вероятности ( r = 0,7, p = 2 × 10 −16 , Корреляции Пирсона). Оценка расстояния в облаке использовалась во всех последующих анализах. Для сравнения мы также сгруппировали данные с помощью спектральной кластеризации, реализованной в пакете R «kernlab» v0.9.27, с использованием двух центров кластеров и настроек по умолчанию 41 .

Вмененные функции из состава микробиоты

Для прогнозирования микробных функций предварительно обработанные считывания ДНК были сопоставлены с версией 13_8 базы данных GreenGenes 16 S рРНК с использованием BURST с идентичностью 97%. Полученные таблицы OTU использовались для создания прогнозируемых аннотаций KEGG с использованием PICRUSt v1.1.3 42 . Затем была использована величина эффекта линейного дискриминантного анализа (LDA) (LEfSe; Galaxy Version 1.0) 43 для выявления предполагаемых функций, которые значительно различались (оценка LDA> 2.0) между группами.

Исследование диетических вмешательств с участием здоровых добровольцев

Это было пилотное проспективное одноцентровое исследование диетических вмешательств с участием здоровых добровольцев, изначально соблюдающих диету с высоким содержанием клетчатки. Исследование было зарегистрировано на сайте clinictrials.gov под номером NCT03266536. Подходящими участниками были здоровые взрослые (≥ 18 лет) с исходным потреблением клетчатки ≥ 11 г / 1000 калорий / день; <10% дневных калорий из добавленного сахара; ≥ 5 порций фруктов и овощей в день; и ≤ 13% дневных калорий из насыщенных жиров на основе заполненного опросника по частоте приема пищи.Пациенты были исключены из исследования, если они не соответствовали вышеуказанным диетическим требованиям, имели известный диагноз воспалительного заболевания кишечника, микроскопический колит, глютеновую болезнь или другие воспалительные состояния, наличие абдоминальных симптомов на основании исходного анкетного опроса, использование пероральных антибиотиков или пробиотиков в течение последние 4 недели, беременность или планы забеременеть в рамках периода исследования, или любые другие заболевания, состояния или привычки, которые могут помешать завершению исследования. Диетические инструкции и выбор продуктов питания обсуждались на предварительном визите лицензированного диетолога.

Все субъекты прошли скрининг лично или по телефону и заполнили анкету по частоте приема пищи, чтобы убедиться, что они соответствуют критериям включения и исключения. При первичном и последующем посещении им была проведена ФГДС с седацией в сознании. Дуоденальный аспират получали через стандартный отсасывающий катетер, пропущенный через отсасывающий порт с минимальным надуванием в желудке; аликвота была отправлена ​​в клиническую лабораторию для тестирования на SIBO, а оставшаяся часть хранилась для анализа микробиома при -80 ° C.Было получено восемь биопсий двенадцатиперстной кишки для исследований в камере Уссинга, анализа микробиома и seq РНК хозяина. При первоначальном и последующем посещении участники заполнили симптоматическую и демографическую анкету и предоставили образец стула. Симптомы, оцененные с помощью анкет, включали: частоту стула, напряжение, неполное опорожнение, твердый / комковатый стул, боль в животе, связанную с дефекацией, диарею / жидкий водянистый стул, вздутие живота, затруднения глотания, тошноту / рвоту, изжогу, усталость и аппетит.Ответы записывались в двоичном формате (да / нет). В рамках вмешательства все участники придерживались 7-дневной стандартизированной диеты с типичным для США распределением макроэлементов калорий: 50% из углеводов, 35% из жиров и 15% из белка. Диета была с низким содержанием клетчатки (<10 г / 1000 калорий в день) и высоким содержанием простого сахара (≥ 50% дневных углеводов).

Статистический анализ мощности

Мы выполнили апостериорный расчет мощности для сравнения микробиома между здоровыми и симптоматическими субъектами, сосредоточив внимание на силе дифференциального анализа численности, где у нас была гораздо более низкая статистическая мощность по сравнению с анализами альфа- и бета-разнообразия. , из-за многократной коррекции тестирования.Мы использовали сетевой калькулятор мощности микробиома для проведения анализа мощности (http://fedematt.shinyapps.io/shinyMB/), который был основан на моделировании Монте-Карло и тесте Вилкоксона – Манна – Уитни 44 . Мы использовали коэффициент ложного обнаружения 5%, чтобы исправить множественное тестирование. Предполагая, что мы тестируем 65 родов, при этом численность 10 родов с умеренной численностью (6–15 ранги) снижается на 50% у пациентов с симптомами (по сравнению с 26 дифференциальными родами со средним снижением на 59% в наблюдаемых данных), мы имели средняя мощность 75% для обнаружения этих 10 дифференциальных родов и мощность 100% для обнаружения хотя бы одного значимого рода при текущем размере выборки.Таким образом, исследование было достаточно мощным, чтобы обнаружить умеренную разницу таксонов при сравнении здоровых субъектов и субъектов с симптомами.

Ex vivo функция эпителиального барьера

Исследования камеры Уссинга были выполнены для измерения барьерной функции слизистой оболочки двенадцатиперстной кишки и секреторных ответов, как было описано ранее 45 . Вкратце, биопсии двенадцатиперстной кишки помещали в камеры Уссинга объемом 4 мл (Physiologic Instruments, Сан-Диего, Калифорния), экспонируя 0,031 см области 2 в течение 45 минут после сбора.Камеры были заполнены Кребсом с 10 мм маннитом (сторона слизистой оболочки) и Кребсом с 10 мм глюкозы (подслизистая сторона). Базовое трансэпителиальное сопротивление и ток короткого замыкания каждой ткани измеряли с использованием пары электродов Ag / AgCl с агар-солевыми мостиками и пары токоподводящих платиновых электродов для поддержания условий фиксации напряжения. Парацеллюлярный поток через биопсии измеряли с использованием 4 кДа FITC-декстрана, вводимого на слизистую (концентрация в камере 1 мг / мл). Отбор образцов производился со стороны подслизистой оболочки каждые 30 минут в течение всего 3 часов, и кумулятивная флуоресценция измерялась с помощью Multi-Mode Microplate Reader (BioTek, VT) и преобразовывалась в концентрацию с использованием стандартных кривых.Кумулятивный поток в конце 3 ч был рассчитан для FITC – декстрана. Корреляции Спирмена (непараметрические) использовали для проверки связи между разнообразием микробиома и потоком FITC – декстрана.

RNA seq

Образцы биопсии размораживали на льду, гомогенизировали и центрифугировали при 13000 об / мин, а супернатант переносили в новую пробирку. РНК получали с использованием набора RNeasy Mini Kit (QIAGEN, Hilden, Германия) и секвенировали на Illumina HiSeq 2500. Анализ данных выполняли с использованием Mayo Analysis Pipeline for RNA Sequencing (MAP-RSeq) с выравниванием по строению генома человека (GRCh48.78) 46 . Вкратце, конвейер MAP-RSeq выполняет оценку качества чтения последовательностей из файла FASTQ, выравнивает оставшиеся оставшиеся чтения с TopHat 47 , а количество генов агрегируется с библиотекой Python HTSeq 48 . Средняя общая глубина считывания составила 57 052 ​​595 (стандартное отклонение 8,5 × 10 6 ) и в среднем 87,0% (стандартное отклонение 2,0%) от общего количества считываний, сопоставленных с моделями генов. Условная квантильная нормализация была выполнена для учета длины гена и ошибок содержания GC 49 .

1 Подготовка образцов метаболомики H-ЯМР

Образцы аспирата центрифугировали при 4 ° C при 12000 × g в течение 5 минут. 162 мкл супернатанта смешивали с 18 мкл буфера ЯМР (1,5 мкл KH 2 PO 4 , 1 г / л TSP и 0,13 г / л NaN 3 , Sigma-Aldrich) и переносили в Трубка для ЯМР 3 мм. Образцы фекалий предварительно взвешивали (~ 100 мг), рандомизировали и помещали в пробирку с завинчивающейся крышкой, содержащую 50 мг 1.Циркониевые шарики диаметром 0 мм, к которым было добавлено 400 мкл ACN: H 2 O (1: 3). Пробирку помещали в миксер Biospec на 30 с. Затем гомогенизированный образец центрифугировали в течение 20 мин при 16000 × g . Супернатант осторожно переносили в пробирки с центрифугированием и центрифугировали в течение 30 мин при 16000 × g . 80 мкл отфильтрованной фекальной воды вносили аликвотами в 96-луночный планшет и 10 мкл использовали для контроля качества. Отфильтрованную фекальную воду в 96-луночном планшете сушили в токе азота перед восстановлением 540 мкл D 2 O (Sigma-Aldrich) и 60 мкл буфера ЯМР.Восстановленную фекальную воду и буферную смесь переносили в 5-миллиметровые экспериментальные пробирки для ЯМР.

1 Эксперимент H-ЯМР

Профили метаболизма измеряли на спектрометре Bruker 600 МГц (Bruker Biospin, Райнштеттен, Германия), установленном на постоянную температуру 300 К для образцов мочи, аспирата и кала и 310 К для образцов плазмы. Стандартный одномерный эксперимент NOSY был выполнен для каждого образца мочи, аспирата и фекальной воды, а эксперимент CPMG - для образцов плазмы.Всего было выполнено 64 сканирования для каждого образца в 64 тыс. Точек данных для мочи, аспиратов и плазмы; Было собрано 128 сканирований на образец в 64 тыс. Точек данных для фекальной воды.

1 Предварительная обработка данных H-ЯМР

Данные спектров были импортированы в MATLAB (версия 8.3.0.532 R2014a, Mathworks Inc, Натик, Массачусетс, США). Для следующих исполнений использовалась серия сценариев собственной разработки. Фазирование, корректировка базовой линии и спектральная калибровка до TSP (0 ppm).Спектры выравнивались вручную. Чтобы учесть разницу в концентрации образцов, к образцам была применена нормализация вероятностного коэффициента. Собственные скрипты использовались для построения моделей PCA и OPLS-DA и интеграции интересующих пиков. Корреляции характеристик и тенденции были проанализированы в R.

Сводка отчетов

Дополнительная информация о дизайне исследования доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Границы | NLR и воспалительные заболевания, связанные с дисбактериозом кишечника: движущие силы или препятствия?

Введение

Здоровый кишечник человека заселен несколькими микроорганизмами, включая грибы, вирусы и бактерии, принадлежащие к разным семействам (1).Исследования микробиома кишечника показывают большое количество бактерий из семейств Bacteroidaceae, Prevotellaceae, Rikenellaceae и Ruminococcaceae в толстой кишке (2). С другой стороны, тонкий кишечник в основном заселен бактериями из семейств Lactobacillaceae и Enterobacteriaceae (3). В последние годы секвенирующий анализ гена 16S рРНК выявил связь между микробиотой кишечника и воспалительными заболеваниями (4). Изменения в составе кишечной микробиоты, процесс, называемый дисбактериозом, играют ключевую роль в патогенезе воспалительных заболеваний, таких как ревматоидный артрит (5), атеросклероз (6), язвенный колит, болезнь Крона (7) и сахарный диабет. типа 1 и 2 (8, 9).Соответственно, модуляция микробиоты кишечника пребиотиками и пробиотиками в качестве профилактических или терапевтических стратегий для смягчения патогенеза воспалительных заболеваний все чаще исследуется (10).

Рецепторы врожденного иммунитета, также называемые рецепторами распознавания образов (PRR), экспрессируются несколькими клетками и участвуют в распознавании микробных продуктов или эндогенных собственных молекул. PRR являются ключевыми компонентами патогенеза воспалительных и аутоиммунных заболеваний (11, 12).Толл-подобные рецепторы (TLR) и NOD-подобные рецепторы (NLR) относятся к основным семействам, составляющим суперсемейство PRR (13). В процессе дисбактериоза увеличенное количество патобионтических бактерий модулирует экспрессию и активацию TLR, что приводит к провоспалительной реакции в кишечнике и вне кишечника (14, 15). С другой стороны, NLR имеют либо положительные, либо вредные эффекты, которые зависят от антимикробных факторов и провоспалительного цитокинового профиля после активации микробиоты кишечника.В этом мини-обзоре подчеркивается различная роль NLR в метаболических и воспалительных заболеваниях, связанных с дисбактериозом кишечника.

Дисбактериоз кишечника при воспалительных заболеваниях

Микробиота кишечника в гомеостазе напрямую связана со здоровьем хозяина. Кишечная микробиота влияет на метаболизм хозяина (16), иммунную систему (17, 18), микробицидные механизмы кишечника (19) и поддерживает кишечный барьер (20). Многие исследования показывают, что факторы окружающей среды, такие как использование антибиотиков (21, 22), диета (23) и стресс (24), могут изменить микробиоту кишечника, увеличивая количество патобионтических бактерий за счет комменсальных бактерий, процесс, известный как дисбиоз ( 25).Дисбактериоз кишечника способствует развитию ряда аутоиммунных, воспалительных и метаболических заболеваний, таких как ревматоидный артрит (РА), воспалительные заболевания кишечника (ВЗК) и сахарный диабет (26, 27). Однако во многих случаях, например, при ВЗК, еще не известно, является ли дисбактериоз причиной или следствием заболевания (28, 29). Точная роль микробиоты кишечника в патогенезе РА также полностью не изучена. Однако у мышей без микробов (GF) наблюдается задержка развития RA по сравнению с контрольной группой (30).На ранних стадиях РА было зарегистрировано уменьшение количества некоторых комменсальных бактерий, например, принадлежащих к роду Bifidobacteria и Bacteroides , и увеличение количества Escherichia coli и Proteus mirabilis (31, 32) . Кроме того, у пациентов с РА наблюдается повышение уровня Prevotella copri (), а также IgA и IgG против P. copri , что позволяет предположить, что эти бактерии могут вносить вклад в патогенез РА (33).

Воспалительные заболевания кишечника, такие как болезнь Крона (БК) и язвенный колит (ЯК), поражают около 3 миллионов человек в Европе и США, причем высокая и ускоренная заболеваемость наблюдается в развивающихся странах (34, 35).Хотя этиология все еще не ясна, генетическая предрасположенность и факторы окружающей среды, такие как диета и использование антибиотиков, являются триггерами этих заболеваний, которые в основном характеризуются хроническим воспалением кишечника (34, 36). Кроме того, нарушение эпителиального барьера и дисбактериоз кишечника широко сообщается у пациентов и в экспериментальных моделях желудочно-кишечных инфекций (37, 38), включая пациентов с ВЗК (39, 40). Метагеномный анализ 16S рРНК показал, что микробиота, присутствующая в кале мышей с ЯК, сильно отличается от микробиоты в кале здоровых мышей, главным образом увеличением видов филума Verrucomicrobia и уменьшением Tenericutes у мышей с колитом, что коррелирует с с более высоким показателем болезни (41, 42).Увеличение количества энтеробактерий наблюдается в образцах кала пациентов с CD (43). Численность Escherichia и Shigella также увеличивается в этом состоянии по сравнению со здоровыми людьми. Кроме того, сообщалось о сокращении количества родов Roseburia, Coprococcus и Ruminococcus , которые являются важными продуцентами бутирата (44, 45). Анализ биопсии толстой кишки у пациентов с ВЗК также показывает снижение Firmicutes и увеличение Bacteroidetes (46), а у пациентов с ВЗК наблюдается повышенное производство биопленок штаммов Enterococcus по сравнению со штаммами из контрольной группы (47).

Несбалансированная микробиота кишечника и изменения барьерной функции кишечника также тесно связаны с патогенезом сахарного диабета (СД) (48). СД включает группу метаболических заболеваний, характеризующихся в основном хронической гипергликемией, возникающей в результате нарушения секреции и / или функциональности инсулина (49). При диабете 1 типа (T1D), также называемом аутоиммунным диабетом, присутствуют аутоантитела, и аутореактивные лимфоциты опосредуют разрушение β-клеток поджелудочной железы, что приводит к полному дефициту инсулина (50).Влияние микробиоты на развитие T1D было продемонстрировано на мышах с дефицитом Myd88 и диабетом без ожирения (NOD), выведенных в условиях, свободных от патогенов (SPF) или микробов (GF). В то время как мыши SPF NOD.Myd88 - / - защищены от T1D, у мышей в условиях GF развивается T1D, что показывает, что защитные эффекты Myd88 зависят от присутствия микробиоты кишечника (51). В этом контексте многие исследования показали различия в составе микробиоты между диабетиками и недиабетическими пациентами, предполагая, что эти изменения связаны с развитием и тяжестью СД1 (52, 53).Исследования бактериального протеома показывают высокое обогащение белками Clostridium и Bacteroides у детей с СД1, тогда как контрольная группа демонстрирует большее обогащение белками Bifidobacterium (54). Кроме того, уменьшение количества видов, продуцирующих лактат и бутират, таких как B. adolescentis , связано с аутоиммунитетом T1D (55).

В моделях диабета 2 типа (T2D) дисбиоз кишечника усугубляет воспалительный процесс, увеличивает проницаемость кишечника, а также изменяет метаболизм короткоцепочечных жирных кислот, которые важны для инсулинорезистентности (56), в дополнение к ускорению развития ожирение, ретинопатия и нефропатия (57).У пациентов с СД2 чрезмерное потребление углеводов и белков связано с дисбалансом микробиоты кишечника, с увеличением рода Clostridium и уменьшением Bifidobacterium spp. и Lactobacillus , помимо непереносимости глюкозы (58). Более того, в экспериментальных моделях СД2 введение бактерий рода Bifidobacterium улучшает толерантность к глюкозе и придает защитную роль в развитии СД2 (59, 60).Точно так же введение Bacteroides acidifaciens снижает инсулинорезистентность и даже предотвращает ожирение (61).

Рецепторы врожденного иммунитета, такие как NLR, играют решающую роль в защите кишечного барьера от различных микроорганизмов из окружающей среды. Эти рецепторы также модулируют микробный состав кишечника, что связано с развитием воспалительных заболеваний (62).

Защитная роль NLR в гомеостазе кишечной микробиоты и ВЗК

Компоненты врожденной иммунной системы являются первым барьером против инфекций и распознают гибель клеток, вызывая быстрый иммунный ответ за счет распознавания патоген-ассоциированного молекулярного паттерна (PAMP) и связанного с повреждением молекулярного паттерна (DAMP) соответственно (63).NLR являются частью множества рецепторов врожденного иммунитета, расположенных во внутриклеточной среде, и инициируют воспалительные процессы. NOD1 и NOD2, центральные члены NLR, в основном распознают бактериальный пептидогликан и, таким образом, индуцируют транскрипцию генов NF-kB и митоген-активируемых протеинкиназ (MAPK), активируя экспрессию провоспалительных факторов различными клетками (13).

Рецептор NOD1 обнаруживает гамма-D-глутамил-мезо-диаминопимелиновую кислоту (γ iE-DAP), пептид, обнаруживаемый в основном в грамотрицательных бактериях, но также и в группах грамположительных бактерий, таких как Listeria spp.и Bacillus spp (64–66). В отсутствие NOD1 происходит размножение некоторых кишечных бактерий, таких как Clostridiales , Bacteroides spp., Сегментированные нитчатые бактерии (SFB) и Enterobacteriaceae. Рецептор NOD2 обнаруживает мурамилдипептид (MDP), присутствующий в бактериальном пептидогликане, и является наиболее важным рецептором в контроле гомеостаза кишечника (67). Этот рецептор контролирует комменсальную микробиоту и устранение патогенных бактерий в кишечных криптах, сводя к минимуму риск воспаления кишечника и колоректального рака (68–70).Интересно, что экспрессия NOD2 зависит от присутствия кишечных комменсальных бактерий, что указывает на положительную обратную связь. Дефицит NOD2 нарушает это гомеостатическое взаимодействие, что приводит к дисбактериозу кишечника и повышенной восприимчивости к ВЗК (69).

Другие NLR также играют важную роль в гомеостазе кишечника. Активация семейства NOD-подобных рецепторов - пиринового домена, содержащего 6 (NLRP6), посредством олигомеризации и сборки белков с комплексом инфламмасом - активирует каспазу-1 и приводит к синтезу IL-1β и IL-18 в кишечном эпителии (71 ).Дефицит NLRP6 в эпителиальных клетках толстой кишки мышей снижает уровень IL-18, способствует дисбактериозу кишечника и увеличивает риск колита (72, 73). IL-18, секретируемый эпителиальными клетками, стимулирует барьерную функцию и регенерацию эпителиальных клеток (73). Кроме того, сама комменсальная микробиота активирует инфламмасому NLRP6, что приводит к выработке слизи бокаловидными клетками и антимикробными пептидами, поддерживая здоровый состав кишечной микробиоты (74).

NLRP3, другой тип NLR, высоко экспрессируется в моноцитарной линии (75) и способствует большей продукции IL-1β по сравнению с IL-18, что приводит к изменениям в составе кишечной микробиоты (76).В нормальных условиях у мышей с дефицитом NLRP3 наблюдается дисбиоз кишечника, связанный с чрезмерным ростом Prevotellaceae и Bacteroidetes (77), тогда как соотношение между Firmicutes и Bacterioidetes уменьшается (78). В отличие от других NLR, NLRP12 обладает противовоспалительным действием, ингибируя канонический и неканонический NF-κB; снижение выработки воспалительных цитокинов, хемокинов и канцерогенных факторов (79–82) и борьба с инфекцией грамотрицательными бактериями (83). Дефицит NLRP12 на модели колита, индуцированного декстрансульфатом натрия (DSS), способствует воспалению толстой кишки, снижает разнообразие кишечной микробиоты и увеличивает количество колитогенных бактерий, таких как семейство Erysipelotrichaceae, что свидетельствует о защитной роли NLRP12 при ВЗК (84).

Расходящиеся роли NLR и AIM2 в развитии T1D

В последние несколько лет несколько линий доказательств продемонстрировали, что члены семейства NLR участвуют в патогенезе T1D. Недавно мы сообщили, что мыши, лишенные NOD2, но не NOD1, устойчивы к индуцированному стрептозотоцином (STZ) T1D и неспособны вызывать иммунный ответ Th2 и Th27 в лимфатических узлах поджелудочной железы (PLN) и поджелудочной железе. Интересно, что у мышей с диабетом наблюдаются изменения в составе микробиоты кишечника, и это связано с транслокацией микробиоты кишечника в PLN (рис. 1).Когда эти мыши подвергаются лечению антибиотиками широкого спектра действия перед инъекциями STZ, у них не развиваются признаки СД1, такие как гипергликемия. Кроме того, введение лиганда NOD2, MDP, способствует развитию STZ-индуцированного T1D у мышей дикого типа (WT), которым вводили антибиотики и инъецировали STZ. Наши результаты демонстрируют, что распознавание микробиоты кишечника NOD2 в PLN запускает провоспалительный ответ, который индуцирует патогенный иммунный ответ клеток Th2 и Th27, тем самым внося вклад в патогенез STZ-индуцированного T1D (Таблица 1) (85).

Рисунок 1 . Экспрессия и дифференциальные функции NLR в развитии диабета 1 типа. Повышенная экспрессия AIM2 была обнаружена в слизистой оболочке кишечника мышей с предиабетом, и его активация вызывает высвобождение IL-18, что, в свою очередь, способствует продукции RegIIIγ. Этот механизм ослабляет дисбактериоз кишечника, укрепляет барьер кишечника и ослабляет ответ лимфоцитов Th2 и Tc1 против продуцирующих инсулин β-клеток, что в конечном итоге защищает от T1D. С другой стороны, NOD2 распознает перемещенный мурамилдипептид (MDP) из дисбиотической микробиоты и способствует активации лимфоцитов Th2 и Th27 при T1D.Наконец, у мышей с диабетом наблюдалась повышающая регуляция экспрессии NLRP3 в PLN, которая активируется в макрофагах путем распознавания митохондриальной ДНК (мДНК), приводит к продукции IL-1β и стимулирует образование патогенных лимфоцитов Th27 и Th2, что приводит к началу T1D.

Таблица 1 . Резюме экспериментальных исследований роли NLR в T1D.

STZ-инъецированные мыши WT демонстрируют увеличение различных групп бактерий в микробиоте кишечника, таких как семейство Bacteroidaceae и род Bacteroides , которые были связаны с повышенной восприимчивостью к T1D у людей (91, 92).Эти результаты повторяют то, что было обнаружено у пациентов с сахарным диабетом 1 типа, при этом тип Bacteroidetes, семейство Bacteroidaceae и род Bacteroides чаще встречаются у детей с положительной реакцией на антитела, чем у сверстников с отрицательной реакцией на антитела (55). Другое важное наблюдение, обнаруженное среди пациентов с диабетом 1 типа, - снижение разнообразия микробиоты, связанное со снижением относительной численности Bifidobacterium, Roseburia, Faecalibacterium и Lachnospira (91).Эти данные показывают, что дисбактериоз кишечника, наблюдаемый у пациентов с диабетом 1 типа, может действовать как триггер окружающей среды в развитии заболевания, и что стратегии, направленные на блокировку передачи сигналов NOD2, появляются в качестве потенциальных методов лечения СД1. Аналогичные результаты были получены на модели спонтанных мышей T1D. У мышей NOD.NOD2 - / - , не связанных с одним домом, наблюдается снижение заболеваемости СД1 и снижение CD4 + IFN-γ + / CD8 + IFN-γ + (Th2 / Tc1) и CD4 + IL-17 + / CD8 + IL-17 + (Th27 / Tc17) Т-клетки в PLN, что указывает на то, что активация NOD2 регулирует развитие T1D, изменяя состав микробиоты кишечника и модулируя адаптивный иммунный ответ ( 86).

Другие исследования также показали, что NLRP3 необходим для патогенеза СД1. Дефицит NLRP3 у мышей NOD защищает от T1D, подавляя экспрессию хемокинов и хемокиновых рецепторов, участвующих в миграции иммунных клеток к островкам поджелудочной железы. Дефицит NLRP3 у мышей NOD снижает экспрессию CCR5 и CXRC3 на Т-клетках, а также экспрессию генов CCL5 и CXCL10 в ткани поджелудочной железы, и эти процессы происходят зависимым от IRF1 образом (87). Кроме того, наша исследовательская группа продемонстрировала, что активация инфламмасомы NLRP3 митохондриальной ДНК (мДНК) способствует высвобождению IL-1β макрофагами, способствуя образованию патогенных клеток Th27 / Th2 в PLN и чувствительности к T1D в модели STZ-индуцированного T1D (рис. , Таблица 1) (88).Соответственно, ассоциативное исследование в северо-восточной части Бразилии выявило два однонуклеотидных полиморфизма (SNP) в NLRP3, rs10754558 и rs358294199, которые связаны с T1D у людей, предполагая, что вариации в NLRP3 могут быть предрасполагающим генетическим фактором для развитие аутоиммунного СД1 (89).

Другой рецептор врожденного иммунитета, который приводит к сборке инфламмасом при его активации, - это датчик ДНК, отсутствующий в меланоме 2 (AIM2) (93, 94). Активация AIM2 участвует в аутоиммунных и воспалительных заболеваниях (95).В модели STZ T1D AIM2 высоко экспрессируется в подвздошной кишке на ранних стадиях заболевания. Интересно, что AIM2 - / - STZ-инъецированные мыши демонстрируют повышенную частоту T1D, повышенную кишечную проницаемость и бактериальную транслокацию в PLN, что приводит к провоспалительному ответу, опосредованному клетками Th2 и Tc1. Когда микробиота кишечника истощается коктейлем антибиотиков широкого спектра действия перед инъекциями STZ, повышенная чувствительность к T1D, наблюдаемая у мышей AIM2 - / - , исчезает (таблица 1).Эффекты, индуцированные активацией AIM2 in vivo , опосредуются высвобождением IL-18, что способствует регенерации продукции III гамма (RegIIIγ) островкового происхождения, таким образом смягчая изменения микробиоты кишечника и усиливая барьерную функцию кишечника. Вместе наши данные показывают, что активация AIM2 ограничивает дисбактериоз кишечной микробиоты, кишечную проницаемость и транслокацию в PLN, снижая провоспалительный ответ и обеспечивая защиту от T1D (90).

Роль NLR в ожирении, СД2 и сопутствующих заболеваниях

Дисбактериоз кишечника может приводить к повышенной проницаемости кишечного барьера, что приводит к системному воспалению низкой степени и метаболическим нарушениям, таким как ожирение, сахарный диабет 2 типа и ишемический инсульт (96, 97).Рецепторы врожденного иммунитета играют роль в системном воспалении, вызванном ожирением. У мышей, получавших диету с высоким содержанием жиров (HFD), наблюдается усиление воспаления толстой кишки и эндотоксемии из-за повышенной кишечной проницаемости слизистой оболочки толстой кишки (98). Кроме того, наблюдается усиление передачи сигналов TLR4 в толстой кишке и активация NF-κB (98). Однако самки мышей, лишенные TLR4, демонстрируют более высокий риск развития ожирения, но также обладают большей защитой от инсулинорезистентности, возможно, из-за отсутствия передачи сигналов TLR4 в органах, важных для метаболического гомеостаза (99).Кроме того, другие исследования показали, что дисбактериоз кишечника способствует состоянию метаболической эндотоксемии при ожирении, что приводит к накоплению ЛПС в крови, мета воспламенению и инсулинорезистентности через путь CD14 / TLR4 (100–102).

T2D - это хроническое метаболическое воспалительное состояние и самый распространенный тип диабета у взрослых во всем мире (103). Это заболевание инициируется обострением дисфункции поджелудочной железы, когда выработка инсулина β-панкреатическими клетками не успевает за увеличением периферической инсулинорезистентности (104, 105).Системное воспаление слабой степени сопровождает диабет с высокими уровнями в сыворотке крови С-реактивного белка (CRP), фактора некроза опухоли (TNF-α), хемопривлекающего моноциты белка-1 (MCP-1) и IL-1β (106, 107 ). Кроме того, ожирение, старение и другие состояния, способствующие хроническому воспалению слабой степени, связаны с повышенным риском развития СД2 (108–110). Системно высокие сывороточные концентрации IL-6, IL-1β и TNF-α увеличивают инсулинорезистентность и вызывают эндотелиальную дисфункцию, стимулируя сосудистую систему к развитию заболеваний, связанных с диабетом, включая системную артериальную гипертензию (111).Между тем, повышенное содержание IL-1β, IL-6 и IL-8 в поджелудочной железе снижает экспрессию гена инсулина в β-панкреатических клетках, что способствует повышению инсулинорезистентности (112).

Точный баланс между активацией врожденных рецепторов NOD1 и NOD2 имеет решающее значение для поддержания периферической резистентности к инсулину. Прямая активация рецепторов NOD1 посредством внутрибрюшинного введения лиганда NOD1 у мышей WT приводит к увеличению периферической инсулинорезистентности в течение 6 часов (113). В этом же исследовании активация NOD1 вызывала небольшое увеличение циркулирующих провоспалительных цитокинов.Кроме того, более высокие концентрации медиаторов воспаления наблюдаются в культурах фибробластов 3T3-L1, дифференцированных в адипоциты и подвергнутых воздействию лигандов NOD1 в течение 18 часов (113). Воспаление периферических тканей, особенно жировой ткани (114), является отличительной чертой СД2 и напрямую способствует его патогенезу через дисфункцию жировой ткани и последующие осложнения энергетического гомеостаза и промежуточного метаболизма (115). В этом контексте мыши NOD1 / NOD2 с двойным нокаутом защищены от периферической инсулинорезистентности и периферического воспаления, наблюдаемых в модели T2D, вызванной ожирением (HFD) (113).

NOD2 - это рецептор врожденного иммунитета, который распознает пептидогликан в клеточной стенке бактерий и, следовательно, представляет собой важное звено между микробиотой кишечника и иммунитетом (116). Следовательно, профиль активации NOD2 может быть важным при метаболических заболеваниях с ответвлениями иммунной системы и, следовательно, может представлять собой связь между микробиотой кишечника и этими заболеваниями. Дефицит NOD2 у мышей способствует большему перемещению бактерий из кишечника (116). В модели HFD мыши с дефицитом NOD2 проявляют большую периферическую резистентность к инсулину, воспаление висцеральной жировой ткани и более высокое содержание бактериальной ДНК в печени (117).HFD увеличивает соотношение Firmicutes к Bacteriodetes, а мыши NOD2 - / - , подвергнутые HFD, демонстрируют дисбактериоз, представленный увеличением количества бактерий Helicobacter () и семейства Peptococcaceae и уменьшением количества бактерий рода Clostridium по сравнению с Мыши WT, получавшие HFD (117). Трансплантация фекалий от мышей с ожирением мышам с худым GF увеличивает общую массу тела и массу жировой ткани. В качестве альтернативы трансплантация фекалий от тощих мышей мышам GF с ожирением снижает массу жировой ткани (118).В этой последней экспериментальной установке наблюдается увеличение количества типов Bacteriodetes в кишечнике, что связано с производством метаболитов микробиоты с модулирующими свойствами хозяина, в частности: SCFAs (118). Интересно, что адекватное потребление пищевых волокон способствует секреции SCFAs кишечной микробиотой. Кроме того, активация рецептора GPR43 у мышей SCFAs в макрофагах M2 жировой ткани приводит к повышенной метаболической активности и способствует поддержанию и гомеостазу здоровой жировой ткани, улучшая метаболическое здоровье (119).

Заключительные замечания

Различные категории NLR модулируют вызванные дисбактериозом кишечника внекишечные и кишечные воспалительные заболевания. Эффекты NLR разнообразны и могут быть как защитными, так и вредными, в зависимости от иммунологического контекста. В кишечнике NLR регулируют состав и транслокацию кишечной микробиоты, влияя на секрецию слизи и продукцию антимикробных пептидов, тем самым играя ключевую роль в защите от воспалительных заболеваний кишечника, таких как язвенный колит и болезнь Крона.Альтернативно, NLR также активируются микробными PAMP (кишечная микробиота) или эндогенными DAMP (компонентами мертвых или умирающих клеток), которые действуют как отрицательные или положительные регуляторы врожденного и адаптивного иммунного ответа и способствуют восприимчивости или устойчивости к метаболическим заболеваниям, таким как как ожирение, диабет 1, 2 типа и их сопутствующие заболевания. Таким образом, фармакологическая модуляция этих рецепторов может представлять новые терапевтические стратегии для этих воспалительных и метаболических заболеваний.

Авторские взносы

JE-O, JL, ÍP, JG и GM в равной степени внесли свой вклад в написание рукописи. JS и RT оказали научную помощь и критически пересмотрели ее. DC координировал и рецензировал рукопись. Все авторы одобрили подачу и публикацию.

Финансирование

Это исследование было поддержано грантами Исследовательского фонда Сан-Паулу (FAPESP) (номера процессов: 2012 / 10395-0; 2018 / 14815-0).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Список литературы

5. Чжан X, Чжан Д., Цзя Х., Фэн К., Ван Д., Лян Д. и др. Микробиомы полости рта и кишечника нарушаются при ревматоидном артрите и частично нормализуются после лечения. Nat Med. (2015) 21: 895–905. DOI: 10,1038 / нм.3914

PubMed Аннотация | CrossRef Полный текст | Google Scholar

6. Карлссон Ф. Х., Фак Ф., Нукау И., Тремароли В., Фагерберг Б., Петранович Д. и др. Симптоматический атеросклероз связан с измененным метагеномом кишечника. Nat Commun. (2012) 3: 1245. DOI: 10.1038 / ncomms2266

PubMed Аннотация | CrossRef Полный текст | Google Scholar

7. Tamboli CP, Neut C, Desreumaux P, Colombel JF. Дисбактериоз при воспалительном заболевании кишечника. Gut. (2004) 53: 1–4. DOI: 10.1136 / gut.53.1.1

CrossRef Полный текст | Google Scholar

8. Тай Н, Вонг Ф.С., Вэнь Л. Роль кишечной микробиоты в развитии сахарного диабета 1-го, 2-го типа и ожирения. Rev Endocr Metab Disord. (2015) 16: 55–65. DOI: 10.1007 / s11154-015-9309-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

14. Ли Х, Ватанабе К., Кимура И. Дисбиоз кишечной микробиоты стимулирует и подразумевает новые терапевтические стратегии для лечения сахарного диабета и связанных с ним метаболических заболеваний. Front Immunol. (2017) 8: 1882. DOI: 10.3389 / fimmu.2017.01882

PubMed Аннотация | CrossRef Полный текст | Google Scholar

15. Frosali S, Pagliari D, Gambassi G, Landolfi R, Pandolfi F, Cianci R.Как сложное взаимодействие между толл-подобными рецепторами, микробиотой и кишечным иммунитетом может влиять на патологию желудочно-кишечного тракта. J Immunol Res. (2015) 2015: 489821. DOI: 10.1155 / 2015/489821

PubMed Аннотация | CrossRef Полный текст | Google Scholar

16. Роуленд И., Гибсон Дж., Хейнкен А., Скотт К., Суонн Дж., Тиле И. и др. Функции кишечной микробиоты: метаболизм питательных веществ и других компонентов пищи. Eur J Nutr. (2018) 57: 1–24. DOI: 10.1007 / s00394-017-1445-8

CrossRef Полный текст | Google Scholar

18.Лазар В., Диту Л.М., Пиркалабиру Г.Г., Георге И., Курутиу С., Холбан А.М. и др. Аспекты взаимодействия микробиоты кишечника и иммунной системы при инфекционных заболеваниях, иммунопатологии и раке. Front Immunol. (2018) 9: 1–1830. DOI: 10.3389 / fimmu.2018.01830

PubMed Аннотация | CrossRef Полный текст | Google Scholar

21. Зарринпар А., Шаикс А., Сюй З.З., Чанг М.В., Мароц, Калифорния, Сагательян А. и др. Вызванное антибиотиками истощение микробиома изменяет метаболический гомеостаз, влияя на передачу сигналов в кишечнике и метаболизм в толстой кишке. Nat Commun. (2018) 9: 2872. DOI: 10.1038 / s41467-018-05336-9

PubMed Аннотация | CrossRef Полный текст

22. Kim HJ, Lee SH, Hong SJ. Вызванный антибиотиками дисбиоз кишечной микробиоты усугубляет атопический дерматит у мышей из-за измененных короткоцепочечных жирных кислот. Allergy Asthma Immunol Res. (2020) 12: 137–48. DOI: 10.4168 / aair.2020.12.1.137

PubMed Аннотация | CrossRef Полный текст | Google Scholar

23. Alou MT, Lagier J, Raoult D.Влияние диеты на микробиоту кишечника и дисбактериоз, связанный с нарушением питания. Hum Microbiome J. (2016) 1: 3–11. DOI: 10.1016 / j.humic.2016.09.001

CrossRef Полный текст | Google Scholar

24. Карл Дж. П., Хэтч А. М., Арчидиаконо С. М., Пирс С. К., Пантоха-Фелисиано И. Г., Доэрти Л. А. и др. Влияние психологических, экологических и физических стрессоров на микробиоту кишечника. Front Microbiol. (2018) 9: 2013. DOI: 10.3389 / fmicb.2018.02013

PubMed Аннотация | CrossRef Полный текст | Google Scholar

29.Бутто Л.Ф., Халлер Д. Дисбиоз при воспалении кишечника: причина или следствие. Int J Med Microbiol. (2016) 306: 302–9. DOI: 10.1016 / j.ijmm.2016.02.010

CrossRef Полный текст | Google Scholar

31. Ваахтовуо Дж., Мунукка Э., Коркеамаки М., Лууккайнен Р., Тойванен П. Фекальная микробиота при раннем ревматоидном артрите. J Rheumatol. (2008) 35: 1500–5.

Google Scholar

32. Ньюкирк М.М., Збар А., Барон М., Манжес АР. Отчетливые паттерны бактериальной колонизации подтипов Escherichia coli связаны со статусом ревматоидного фактора при раннем воспалительном артрите. Ревматология. (2010) 49: 1311–6. DOI: 10.1093 / ревматология / keq088

PubMed Аннотация | CrossRef Полный текст | Google Scholar

33. Пианта А., Арвикар С., Стрле К., Дроуин Е.Е., Ван К., Костелло С.Э. и др. Доказательства иммунной значимости кишечного микроба prevotella copri у пациентов с ревматоидным артритом. Arthritis Rheumatol. (2017) 69: 964–75. DOI: 10.1002 / art.40003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

34.Ni J, Wu GD, Albenberg L, Tomov VT. Микробиота кишечника и ВЗК: причинная связь или корреляция? Nat Publ Gr. (2017) 14: 573–84. DOI: 10.1038 / nrgastro.2017.88

CrossRef Полный текст | Google Scholar

35. Соавторы G 2017 IBD. Глобальное, региональное и национальное бремя воспалительных заболеваний кишечника в 195 странах и территориях, 1990-2017 гг .: систематический анализ для исследования глобального бремени болезней, 2017 г. Lancet Gastroenterol Hepatol. (2020) 5: 17–30.DOI: 10.1016 / S2468-1253 (19) 30333-4

CrossRef Полный текст | Google Scholar

36. Маттос БРР, Гарсия М.П.Г., Ногейра Дж.Б., Пайатто Л.Н., Альбукерке К.Г., Соуза К.Л. и др. Воспалительное заболевание кишечника: обзор иммунных механизмов и биологических методов лечения. Медиаторы воспаления. (2015) 2015: 493012. DOI: 10.1155 / 2015/493012

PubMed Аннотация | CrossRef Полный текст | Google Scholar

37. Битти Дж. К., Акиерман С. В., Мотта Дж. П., Муиз С., Воркентин М. Л., Харрисон Дж. Дж. И др.Giardia duodenalis вызывает патогенный дисбиоз биопленок кишечной микробиоты человека. Int J Parasitol. (2017) 47: 311–26. DOI: 10.1016 / j.ijpara.2016.11.010

PubMed Аннотация | CrossRef Полный текст | Google Scholar

38. Yu LCH, Shih YA, Wu LL, Lin YD, Kuo W.T., Peng WH, et al. Кишечный дисбактериоз способствует развитию устойчивых к антибиотикам бактериальных инфекций: системного распространения устойчивых и комменсальных бактерий через эпителиальный трансцитоз. Am J Physiol Gastrointest Liver Physiol. (2014) 307: G824–35. DOI: 10.1152 / ajpgi.00070.2014

PubMed Аннотация | CrossRef Полный текст | Google Scholar

39. Пророк-Хамон М., Фрисвелл М.К., Алсвид А., Робертс К.Л., Сонг Ф., Фланаган П.К. и др. Связанные со слизистой оболочкой толстой кишки диффузно адгезивные afaC + Escherichia coli , экспрессирующие lpfA и pks, увеличиваются при воспалительном заболевании кишечника и раке толстой кишки. Gut. (2014) 63: 761–70. DOI: 10.1136 / gutjnl-2013-304739

PubMed Аннотация | CrossRef Полный текст | Google Scholar

41.Саманта А.К., Торок В.А., Перси Нью-Джерси, Абимослех С.М., Ховарт Г.С. Микробный дактилоскопический анализ позволяет выявлять уникальные бактериальные сообщества в фекальной микробиоте крыс с экспериментально вызванным колитом. J Microbiol. (2012) 50: 218–25. DOI: 10.1007 / s12275-012-1362-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

42. Нагалингам Н.А., Као Дж.Й., Янг В.Б. Микробная экология кишечника мышей, связанная с развитием колита, индуцированного декстран-сульфатом натрия. Воспаление кишечника. (2011) 17: 917–26. DOI: 10.1002 / ibd.21462

PubMed Аннотация | CrossRef Полный текст | Google Scholar

43. Сексик П., Риготтье-Гойс Л., Грамет Г., Сутрен М., Почарт П., Марто П. и др. Изменения доминирующих фекальных бактериальных групп у пациентов с болезнью Крона толстой кишки. Gut. (2003) 52: 237–42. DOI: 10.1136 / gut.52.2.237

PubMed Аннотация | CrossRef Полный текст | Google Scholar

44. Чен Л., Ван В., Чжоу Р., Нг С.К., Ли Дж., Хуанг М. и др.Характеристики фекальной и слизистой микробиоты у китайских пациентов с воспалительным заболеванием кишечника. Медицина. (2014) 93: e51. DOI: 10.1097 / MD.0000000000000051

PubMed Аннотация | CrossRef Полный текст | Google Scholar

45. Ковальска-Дуплага К., Госевски Т., Капуста П., Срока-Олексяк А., Ведрихович А., Печарковский С. и др. Различия в микробиоме кишечника здоровых детей и пациентов с впервые диагностированной болезнью Крона. Sci Rep. (2019) 9: 18880. DOI: 10.1038 / s41598-019-55290-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

46. Уокер А. В., Сандерсон Дж. Д., Черчер С., Паркс Г. С., Хадспит Б. Н., Реймент Н. и др. Высокопроизводительный анализ библиотеки клонов микробиоты, связанной со слизистой оболочкой, выявляет дисбактериоз и различия между воспаленными и невоспаленными участками кишечника при воспалительном заболевании кишечника. BMC Microbiol. (2011) 11: 7. DOI: 10.1186 / 1471-2180-11-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

47.Golinska E, Tomusiak A, Gosiewski T, Wiecek G, Machul A, Mikolajczyk D, et al. Факторы вирулентности штаммов Enterococcus , выделенных от пациентов с воспалительным заболеванием кишечника. World J Gastroenterol. (2013) 19: 3562–72. DOI: 10.3748 / wjg.v19.i23.3562

PubMed Аннотация | CrossRef Полный текст | Google Scholar

48. Лу Дж., Ма К.Л., Руань XZ. Дисбиоз микробиоты кишечника способствует развитию сахарного диабета. Инфекционные микробы Dis. (2019) 1: 43–8.DOI: 10.1097 / IM9.0000000000000011

CrossRef Полный текст | Google Scholar

51. Вен Л., Лей Р. Е., Волчков П. Ю., Странджес П. Б., Аванесян Л., Стоунбрейкер А. С. и др. Врожденный иммунитет и микробиота кишечника в развитии диабета 1 типа. Природа. (2008) 455: 1109–13. DOI: 10.1038 / nature07336

PubMed Аннотация | CrossRef Полный текст | Google Scholar

53. Джамшиди П., Хасанзаде С., Тахвилдари А., Фарси Й., Арбаби М., Мота Дж. Ф. и др. Есть ли связь между микробиотой кишечника и диабетом 1 типа? Систематический обзор. Gut Pathog. (2019) 11:49. DOI: 10.1186 / s13099-019-0332-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

54. Пинто Е., Ансельмо М., Калха М., Боттрилл А., Дуарте И., Эндрю П. У. и др. Кишечный протеом детей с диабетом и контрольной группы обогащен различными микробными белками и белками хозяина. Микробиология. (2017) 163: 161–74. DOI: 10.1099 / mic.0.000412

PubMed Аннотация | CrossRef Полный текст | Google Scholar

55.де Гоффау М.С., Луопаярви К., Книп М., Илонен Дж., Руохтула Т., Харконен Т. и др. Состав фекальной микробиоты у детей с бета-клеточным аутоиммунитетом и без него различается. Диабет. (2013) 62: 1238–44. DOI: 10.2337 / db12-0526

PubMed Аннотация | CrossRef Полный текст | Google Scholar

56. Сиркана А., Фрамарин Л., Леоне Н., Беррутти М., Кастеллино Ф., Паренте Р. и др. Изменение микробиоты кишечника при диабете 2 типа: просто совпадение? Curr Diab Rep. (2018) 18:98.DOI: 10.1007 / s11892-018-1057-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

57. Фернандес Р., Виана С.Д., Нунес С., Рейс Ф. Диабетический дисбактериоз кишечной микробиоты как воспаление и состояние иммунного старения, которое способствует прогрессированию ретинопатии и нефропатии. Biochim Biophys Acta Mol Basis Dis. (2019) 1865: 1876–97. DOI: 10.1016 / j.bbadis.2018.09.032

PubMed Аннотация | CrossRef Полный текст | Google Scholar

58. Ямагути Ю., Адачи К., Сугияма Т., Симозато А., Эби М., Огасавара Н. и др.Связь кишечной микробиоты с метаболическими маркерами и диетическими привычками у пациентов с сахарным диабетом 2 типа. Пищеварение. (2016) 94: 66–72. DOI: 10.1159 / 000447690

PubMed Аннотация | CrossRef Полный текст | Google Scholar

59. Ле ТКС, Хосака Т., Нгуен Т.Т., Кассу А., Данг Т.О., Тран HB и др. Виды Bifidobacterium снижают уровень глюкозы в сыворотке, увеличивают экспрессию сигнальных белков инсулина и улучшают профиль адипокина у мышей с диабетом. Biomed Res. (2015) 36: 63–70.DOI: 10.2220 / биомедры.36.63

PubMed Аннотация | CrossRef Полный текст | Google Scholar

60. Кикучи К., Бен Отман М., Сакамото К. Стерилизованные бифидобактерии подавляли накопление жира и уровень глюкозы в крови. Biochem Biophys Res Commun. (2018) 501: 1041–7. DOI: 10.1016 / j.bbrc.2018.05.105

PubMed Аннотация | CrossRef Полный текст | Google Scholar

61. Ян Дж.Й., Ли Ю.С., Ким И., Ли Ш., Рю С., Фукуда С. и др. Комменсал кишечника Bacteroides acidifaciens предотвращает ожирение и улучшает чувствительность к инсулину у мышей. Mucosal Immunol. (2017) 10: 104–16. DOI: 10,1038 / mi.2016.42

PubMed Аннотация | CrossRef Полный текст | Google Scholar

63. Даолин Т., Руи К., Койн С.Б., Зе Х.Дж., Лотце М.Т. PAMP и DAMP: сигнальные 0, которые стимулируют аутофагию и иммунитет. Immunol Rev. (2012) 249: 158–75. DOI: 10.1111 / j.1600-065X.2012.01146.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

64. Жирардин С.Е., Травассос Л.Х., Эрве М., Блано Д., Бонека И.Г., Филпотт Д.Д. и др.Требования к молекулам пептидогликана, позволяющие обнаруживать их с помощью Nod1 и Nod2. J. Biol Chem. (2003) 278: 41702–8. DOI: 10.1074 / jbc.M307198200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

65. Girardin SE, Boneca IG, Carneiro LAM, Antignac A, Jéhanno M, Viala J, et al. Nod1 обнаруживает уникальный муропептид из грамотрицательного бактериального пептидогликана. Наука. (2003) 300: 1584–7. DOI: 10.1126 / science.1084677

PubMed Аннотация | CrossRef Полный текст | Google Scholar

66.Чамайлард М., Хашимото М., Хори Й., Масумото Дж., Цю С., Сааб Л. и др. Существенная роль NOD1 в распознавании хозяином бактериального пептидогликана, содержащего диаминопимелиновую кислоту. Nat Immunol. (2003) 4: 702–7. DOI: 10.1038 / ni945

PubMed Аннотация | CrossRef Полный текст | Google Scholar

67. Инохара Н., Огура Ю., Фонтальба А., Гутьеррес О., Понс Ф., Креспо Дж. И др. Распознавание хозяином бактериального мурамилдипептида, опосредованного NOD2: последствия для болезни Крона. J. Biol Chem. (2003) 278: 5509–12. DOI: 10.1074 / jbc.C200673200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

68. Рехман А., Сина С., Гаврилова О., Хеслер Р., Отт С., Бейнс Дж. Ф. и др. Nod2 необходим для временного развития кишечных микробных сообществ. Gut. (2011) 60: 1354–62. DOI: 10.1136 / gut.2010.216259

PubMed Аннотация | CrossRef Полный текст | Google Scholar

69. Петницки-Оквейя Т., Хрнцир Т., Лю Ю.Дж., Бисвас А., Худкович Т., Тласкалова-Хогенова Х. и др.Nod2 необходим для регуляции комменсальной микробиоты в кишечнике. Proc Natl Acad Sci USA. (2009) 106: 15813–8. DOI: 10.1073 / pnas.02106

PubMed Аннотация | CrossRef Полный текст | Google Scholar

70. Кутюрье-Майяр А., Секер Т., Рехман А., Норманд С., Де Арканджелис А., Хеслер Р. и др. NOD2-опосредованный дисбиоз предрасполагает мышей к трансмиссивному колиту и колоректальному раку. J Clin Invest. (2013) 123: 700–11. DOI: 10.1172 / JCI62236

PubMed Аннотация | CrossRef Полный текст | Google Scholar

72.Леви М., Таисс К.А., Зееви Д., Дохналова Л., Зильберман-Шапира Г., Махди Дж. А. и др. Метаболиты, модулируемые микробиотой, формируют микроокружение кишечника, регулируя передачу сигналов воспаления NLRP6. Ячейка. (2015) 163: 1428–43. DOI: 10.1016 / j.cell.2015.10.048

PubMed Аннотация | CrossRef Полный текст | Google Scholar

73. Элинав Э., Стровиг Т., Кау А.Л., Хенао-Мехиа Дж., Тайс, Калифорния, Бут CJ и др. Инфламмасома NLRP6 регулирует микробную экологию толстой кишки и риск колита. Ячейка. (2011) 145: 745–57. DOI: 10.1016 / j.cell.2011.04.022

PubMed Аннотация | CrossRef Полный текст | Google Scholar

74. Wlodarska M, Thaiss CA, Nowarski R, Henao-Mejia J, Zhang JP, Brown EM, et al. Инфламмасома NLRP6 управляет интерфейсом кишечника хозяин-микроб, регулируя секрецию слизи бокаловидными клетками. Ячейка. (2014) 156: 1045–59. DOI: 10.1016 / j.cell.2014.01.026

PubMed Аннотация | CrossRef Полный текст | Google Scholar

75.Awad F, Assrawi E, Jumeau C, Georgin-Lavialle S, Cobret L, Duquesnoy P и др. Влияние поляризации человеческих моноцитов и макрофагов на экспрессию NLR и активацию инфламмасомы NLRP3. PLoS ONE. (2017) 12: e0175336. DOI: 10.1371 / journal.pone.0175336

PubMed Аннотация | CrossRef Полный текст | Google Scholar

76. Яо Х, Чжан Ц., Син И, Сюэ Г, Чжан Ц., Пан Ф и др. Ремоделирование кишечной микробиоты гиперактивным NLRP3 побуждает регуляторные Т-клетки поддерживать гомеостаз. Nat Commun. (2017) 8: 1–17. DOI: 10.1038 / s41467-017-01917-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

77. Хенао-Мейджиа Дж., Элинав Э., Джин С., Хао Л., Мехал В.З., Строиг Т. и др. Инфламмасомный дисбиоз регулирует прогрессирование НАЖБП и ожирения. Природа. (2012) 482: 179–85. DOI: 10.1038 / nature10809

PubMed Аннотация | CrossRef Полный текст | Google Scholar

79. Уильямс К.Л., Лич Дж. Д., Дункан Дж. А., Рид В., Раллабанди П., Мур С. и др.Белок CATERPILLER Monarch-1 является антагонистом toll-подобных рецепторов, фактора некроза опухоли α- и провоспалительных сигналов, индуцированных Mycobacterium tuberculosis. J. Biol Chem. (2005) 280: 39914–24. DOI: 10.1074 / jbc.M502820200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

80. Lich JD, Williams KL, Moore CB, Arthur JC, Davis BK, Taxman DJ и др. Передний край: monarch-1 подавляет неканоническую активацию NF-κB и p52-зависимую экспрессию хемокинов в моноцитах. J Immunol. (2007) 178: 1256–60. DOI: 10.4049 / jimmunol.178.3.1256

PubMed Аннотация | CrossRef Полный текст | Google Scholar

81. Аллен И.К., Уилсон Дж. Э., Шнайдер М., Лич Дж. Д., Робертс Р. А., Артур Дж. К. и др. NLRP12 подавляет воспаление толстой кишки и онкогенез за счет негативной регуляции неканонической передачи сигналов NF-κB. Иммунитет. (2012) 36: 742–54. DOI: 10.1016 / j.immuni.2012.03.012

PubMed Аннотация | CrossRef Полный текст | Google Scholar

82.Заки М.Х., Фогель П., Малиредди Р.КС., Боди-Малапель М., Ананд П.К., Бертин Дж. И др. NOD-подобный рецептор NLRP12 ослабляет воспаление толстой кишки и онкогенез. Cancer Cell. (2011) 20: 649–60. DOI: 10.1016 / j.ccr.2011.10.022

PubMed Аннотация | CrossRef Полный текст | Google Scholar

83. Владимер Г.И., Венг Д., Пакетт SWM, Ваная С.К., Ратинам ВАК, Ауне М.Х. и др. Инфламмасома NLRP12 распознает yersinia pestis. Иммунитет. (2012) 37: 96–107. DOI: 10.1016 / j.иммунитет.2012.07.006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

84. Chen L, Wilson JE, Koenigsknecht MJ, Chou WC, Montgomery SA, Truax AD, et al. NLRP12 ослабляет воспаление толстой кишки, поддерживая микробное разнообразие толстой кишки и способствуя защитному росту комменсальных бактерий. Nat Immunol. (2017) 18: 541–51. DOI: 10.1038 / ni.3690

CrossRef Полный текст | Google Scholar

85. Коста FRC, Francozo MCS, de Oliveira GG, Ignacio A, Castoldi A, Zamboni DS, et al.Транслокация кишечной микробиоты в лимфатические узлы поджелудочной железы запускает активацию NOD2 и способствует возникновению T1D. J Exp Med. (2016) 213: 1223–39. DOI: 10.1084 / jem.20150744

PubMed Аннотация | CrossRef Полный текст | Google Scholar

86. Ли YY, Пирсон JA, Chao C, Peng J, Zhang X, Zhou Z и др. Нуклеотид-связывающий домен олигомеризации, содержащий белок 2 (Nod2), модулирует восприимчивость к TIDM микробиотой кишечника. J Аутоиммун. (2017) 82: 85–95. DOI: 10.1016 / j.jaut.2017.05.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

87. Ху Ц., Дин Х, Ли Й, Пирсон Дж. А., Чжан Х, Флавелл Р. А. и др. Дефицит NLRP3 защищает от диабета 1 типа за счет регуляции хемотаксиса островков поджелудочной железы. Proc Natl Acad Sci USA. (2015) 112: 11318–23. DOI: 10.1073 / pnas.1513509112

PubMed Аннотация | CrossRef Полный текст | Google Scholar

88. Карлос Д., Коста, Франция, Перейра, Калифорния, Роча, Ф.А., Яочите, JNU, Oliveira GG, et al.Митохондриальная ДНК активирует инфламмасому NLRP3 и предрасполагает к диабету 1 типа на мышиной модели. Front Immunol. (2017) 8: 164. DOI: 10.3389 / fimmu.2017.00164

PubMed Аннотация | CrossRef Полный текст | Google Scholar

89. Pontillo A, Brandao L, Guimaraes R, Segat L, Araujo J, Crovella S. Два SNP в гене NLRP3 вовлечены в предрасположенность к диабету 1 типа и целиакии в педиатрической популяции из северо-восточной Бразилии. Аутоиммунитет. (2010) 43: 583–9.DOI: 10.3109 / 08916930

0432

PubMed Аннотация | CrossRef Полный текст | Google Scholar

90. Лейте Дж. А., Пессенда Дж., Герра-Гомес ИК, де Сантана АКМ, Андре Перейра С., Рибейро Кампос Коста Ф и др. ДНК-сенсор AIM2 защищает от индуцированного стрептозотоцином диабета 1 типа, регулируя гомеостаз кишечника через путь IL-18. Ячейки. (2020) 9: 959. DOI: 10.3390 / Cell

59

PubMed Аннотация | CrossRef Полный текст | Google Scholar

91.Murri M, Leiva I., Gomez-Zumaquero JM, Tinahones FJ, Cardona F, Soriguer F и др. Микробиота кишечника у детей с диабетом 1 типа отличается от таковой у здоровых детей: исследование случай-контроль. BMC Med. (2013) 11:46. DOI: 10.1186 / 1741-7015-11-46

PubMed Аннотация | CrossRef Полный текст | Google Scholar

92. Паттерсон Е., Маркес Т.М., О'Салливан О., Фицджеральд П., Фицджеральд Г.Ф., Коттер П.Д. и др. Стрептозотоцин-индуцированный диабет типа 1 у крыс Sprague-Dawley связан с измененным составом кишечной микробиоты и уменьшением разнообразия. Микробиология. (2015) 161: 182–93. DOI: 10.1099 / mic.0.082610-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

93. Хорнунг В., Аблассер А., Шаррел-Деннис М., Бауэрнфейнд Ф., Хорват Г., Кэффри Д. Р. и др. AIM2 распознает цитозольную дцДНК и формирует воспаление, активирующее каспазу-1, с ASC. Природа. (2009) 458: 514–8. DOI: 10.1038 / nature07725

PubMed Аннотация | CrossRef Полный текст | Google Scholar

94. Ратинам ВАК, Цзян Цзинь, Ваггонер С.Н., Шарма С., Коул Л. Е., Ваггонер Л. и др.Инфламмасома AIM2 необходима для защиты хозяина от цитозольных бактерий и ДНК-вирусов. Nat Immunol. (2010) 11: 395–402. DOI: 10.1038 / ni.1864

PubMed Аннотация | CrossRef Полный текст | Google Scholar

95. Ман С.М., Карки Р., Каннеганти Т-Д. Инфламмасома AIM2 при инфекции, раке и аутоиммунитете: роль в распознавании ДНК, воспалении и врожденном иммунитете. Eur J Immunol. (2016) 46: 269–80. DOI: 10.1002 / eji.201545839

PubMed Аннотация | CrossRef Полный текст | Google Scholar

96.Ямасиро К., Танака Р., Урабе Т., Уэно Ю., Ямаширо Ю., Номото К. и др. Дисбактериоз кишечника связан с метаболизмом и системным воспалением у пациентов с ишемическим инсультом. PLoS ONE. (2017) 12: e0171521. DOI: 10.1371 / journal.pone.0171521

CrossRef Полный текст | Google Scholar

97. Pasini E, Corsetti G, Assanelli D, Testa C, Romano C, Dioguardi FS, et al. Влияние хронических упражнений на микробиоту кишечника и кишечный барьер у человека с диабетом 2 типа. Minerva Med. (2019) 110: 3–11. DOI: 10.23736 / S0026-4806.18.05589-1

PubMed Аннотация | CrossRef Полный текст | Google Scholar

98. Ким К.А., Гу В, Ли И.А., Джон Э.Х., Ким Д.Х. Микробиота кишечника, вызванная диетой с высоким содержанием жиров, усугубляет воспаление и ожирение у мышей через сигнальный путь TLR4. PLoS ONE. (2012) 7: e47713. DOI: 10.1371 / journal.pone.0047713

PubMed Аннотация | CrossRef Полный текст | Google Scholar

99. Ши Х, Кокоева М.В., Иноуэ К., Цамели И., Инь Х, Флиер Дж. С..TLR4 связывает врожденный иммунитет и резистентность к инсулину, вызванную жирными кислотами. J Clin Invest. (2006) 116: 3015–25. DOI: 10.1172 / JCI28898

PubMed Аннотация | CrossRef Полный текст | Google Scholar

100. Кани П.Д., Амар Дж., Иглесиас М.А., Погги М., Кнауф С., Бастелика Д. и др. Метаболическая эндотоксемия вызывает ожирение и инсулинорезистентность. Диабет. (2007) 56: 1761–72. DOI: 10.2337 / db06-1491

PubMed Аннотация | CrossRef Полный текст | Google Scholar

101.Поджи М., Бастелика Д., Гуаль П., Иглесиас М.А., Гремо Т., Кнауф С. и др. Мыши C3H / HeJ, несущие мутацию toll-подобного рецептора 4, защищены от развития инсулинорезистентности в белой жировой ткани в ответ на диету с высоким содержанием жиров. Diabetologia. (2007) 50: 1267–76. DOI: 10.1007 / s00125-007-0654-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

102. Луч Э., Кузен Б., Гариду Л., Серино М., Вагет А., Барро С. и др. Метаболическая эндотоксемия напрямую увеличивает пролиферацию предшественников адипоцитов в начале метаболических заболеваний через CD14-зависимый механизм. Mol Metab. (2013) 2: 281–91. DOI: 10.1016 / j.molmet.2013.06.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

103. Пайпер М.С., Саад Р.Дж. Сахарный диабет и Cclon. Curr Treat Options Гастроэнтерол. (2017) 15: 460–74. DOI: 10.1007 / s11938-017-0151-1

CrossRef Полный текст | Google Scholar

104. Аларкон К., Боланд Б. Б., Учизоно Ю., Мур П. С., Петерсон Б., Раджан С. и др. Адаптивная пластичность β-клеток поджелудочной железы при ожирении увеличивает выработку инсулина, но отрицательно влияет на секреторную функцию. Диабет. (2016) 65: 438–50. DOI: 10.2337 / db15-0792

PubMed Аннотация | CrossRef Полный текст | Google Scholar

106. Рандерия С.Н., Томсон Г.Я., Нелл Т.А., Робертс Т., Преториус Э. Воспалительные цитокины при сахарном диабете 2 типа как способствующие гиперкоагуляции и аномальное образование тромбов. Cardiovasc Diabetol. (2019) 18:72. DOI: 10.1186 / s12933-019-0870-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

107.Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM. Повышенная экспрессия фактора некроза опухоли-α в жировой ткани при ожирении и инсулинорезистентности человека. J Clin Invest. (1995) 95: 2409–15. DOI: 10.1172 / JCI117936

PubMed Аннотация | CrossRef Полный текст | Google Scholar

108. Ян С.Т., Цзя Дж.Х., Лв XF, Шао Ю.Х., Инь С.Н., Чжан XG и др. Гликемический контроль и комплексный контроль метаболических факторов риска у пожилых людей с диабетом 2 типа. Exp Gerontol. (2019) 127: 110713. DOI: 10.1016 / j.exger.2019.110713

PubMed Аннотация | CrossRef Полный текст | Google Scholar

109. Маскаринек Г., Садакане А., Сугияма Х., Бреннер А., Тацукава Ю., Грант Е. Диабет 2 типа, ожирение и риск рака груди среди японских женщин из когорты выживших после атомной бомбы. Cancer Epidemiol. (2019) 60: 179–84. DOI: 10.1016 / j.canep.2019.04.009

PubMed Аннотация | CrossRef Полный текст | Google Scholar

110. Ли С., Лейси М.Э., Янкович М., Корреа А., Ву WC.Связь между фенотипами ожирения и инсулинорезистентностью и риском диабета 2 типа у афроамериканцев: исследование сердца Джексона. J Clin Transl Endocrinol. (2020) 19: 100210. DOI: 10.1016 / j.jcte.2019.100210

PubMed Аннотация | CrossRef Полный текст | Google Scholar

112. Hotamisligil GkS, Peraldi P, Budavari A, Ellis R, White MF, Spiegelman BM. IRS-1-опосредованное ингибирование активности тирозинкиназы рецептора инсулина при резистентности к инсулину, индуцированной TNF-альфа и ожирением. Наука. (1996) 271: 665–70. DOI: 10.1126 / science.271.5249.665

PubMed Аннотация | CrossRef Полный текст | Google Scholar

113. Шерцер Дж. Д., Тамракар А. К., Магальяйнс Дж. Г., Перейра С., Билан П. Дж., Фуллертон М. Д. и др. Активаторы NOD1 связывают врожденный иммунитет с инсулинорезистентностью. Диабет. (2011) 60: 2206–15. DOI: 10.2337 / db11-0004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

114. Rakotoarivelo V, Lacraz G, Mayhue M, Brown C, Rottembourg D, Fradette J, et al.Профили воспалительных цитокинов во висцеральной и подкожной жировой ткани у пациентов с ожирением, перенесших бариатрическую операцию, показывают отсутствие корреляции с ожирением или диабетом. EBioMedicine. (2018) 30: 237–47. DOI: 10.1016 / j.ebiom.2018.03.004

CrossRef Полный текст | Google Scholar

116. de Souza PR, Guimarães FR, Sales-Campos H, Bonfá G, Nardini V, Chica JEL, et al. Отсутствие рецептора NOD2 предрасполагает к воспалению кишечника из-за нарушения регуляции иммунного ответа у хозяев, которые не могут контролировать дисбактериоз кишечника. Иммунобиология. (2018) 223: 577–85. DOI: 10.1016 / j.imbio.2018.07.003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

117. Дену Е., Лольмед К., Гариду Л., Поми С., Чабо С., Лау Т.С. и др. Нарушение восприятия пептидогликана NOD 2 способствует воспалению, дисбактериозу и инсулинорезистентности, вызванному диетой. EMBO Mol Med. (2015) 7: 259–74. DOI: 10.15252 / emmm.201404169

PubMed Аннотация | CrossRef Полный текст | Google Scholar

118.Muegge BD, Kuczynski J, Knights D, Clemente JC, González A, Fontana L, et al. Диета способствует сближению функций микробиома кишечника в филогенезе млекопитающих и в организме человека.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *